Labshake search
Citations for Qiagen :
1 - 50 of 492 citations for IL 15 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Immunology 2019Quote: ... IL-23p19 primers were purchased from QIAGEN and the sequence for osteopontin primers are ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Microbiology 2022Quote: ... and loaded onto Biosprint 15 (Qiagen) for purification ...
-
bioRxiv - Microbiology 2022Quote: ... and loaded onto Biosprint 15 (Qiagen). Proteins were washed two times with 750 μl of buffer A (or AG ...
-
bioRxiv - Immunology 2023Quote: ... and 15 µl of HiPerFect (Qiagen) transfection reagent was added ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 1.0–3.0 μl (5.0–15 pmol) of primers and 7.5–15 μl of 2x Multiplex PCR Plus Master mix (QIAGEN). The PCR protocol consisted of an initial DNA polymerase (HotStar Taq ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0) containing 15 mg/mL of lysozyme + 15 µL of proteinase K solution (20 mg/mL, Qiagen), and then incubated for 8–10 min ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extractions were carried out using the Biosprint 15 DNA Plant Kit and Biosprint 15 robot (Qiagen, Australia) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 15 min of DNase I (Qiagen) treatment according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 15 µl of Pyrosequencing Annealing Buffer (Qiagen) were mixed with 15 µl of each sample and overhangs were quantified by Pyrosequencing using the following dispensation order GTGTGTCACACATGTGTGTG (nucleotides were pipetted in a two-fold dilution ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 15 min of DNase I (Qiagen) treatment.
-
bioRxiv - Evolutionary Biology 2023Quote: ... each of 15 μL of EB (Qiagen) buffer incubated at 37 C for 10 minutes.
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Systems Biology 2020Quote: ... IL-8 ELISA was performed according to manufacturer instructions (Qiagen).
-
bioRxiv - Evolutionary Biology 2021Quote: ... A selection of four candidate markers were tested for polymorphism and sex-linkage using 15 adult males and 15 adult females in two Multiplex PCR Kit reactions (Qiagen; see Supplemental Table 1 for primer sequences and Supplemental Table 2 for PCR conditions) ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs were extracted from 20 heads (or 15 thoraces or 15 abdomens) of 8-day-old flies using the QIAzol Lysis reagent (Qiagen). The Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: Genomic DNA was extracted from frozen ground young leaf using the BioSprint 15 Plant Kit on the BioSprint 15 Workstation (Qiagen, Crawley ...
-
Sweetwater: an underrated crude glycerol for sustainable lipid production in non-conventional yeastsbioRxiv - Systems Biology 2023Quote: ... tubes were vortexed for 15 s and submitted to cell disruption for 15-min at 4°C using a TissueLyser II (Qiagen) at 30 Hz ...
-
bioRxiv - Developmental Biology 2023Quote: ... and eluted in 15 μl Buffer EB (QIAGEN). 1 ng of pre-amplified cDNA was used for the tagmentation reaction (55C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15 µl Hi-PerFect Transfection Reagent (Qiagen; #301705) and 60 µl of siRNA mixture (1 µM ...
-
bioRxiv - Molecular Biology 2020Quote: ... approximately half of the infected tissue was cut into small pieces and DNA was extracted using a BioSprint 15 instrument and BioSprint 15 DNA plant kit (Qiagen, Australia) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR analysis was performed using 15 ng of cDNA to a final volume of 15 μL reaction with Rotor-Gene SYBR® Green PCR Kit (Qiagen), in a Rotor Gene-Q (R ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Bioengineering 2022Quote: Decellularization for porcine AECMs met the stringent criteria for decellularized ECM.15 Residual dsDNA content was quantified from 15 mg of powdered ECM using the QIAamp DNA Mini Kit (QIAgen, Germantown, MD) followed by Qubit 2.0 (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... that included a 15 min DNAse treatment (Qiagen, 79254) treatment at RT ...
-
bioRxiv - Immunology 2020Quote: ... with a 15-minute on-column DNase digestion (Qiagen) to remove genomic DNA ...
-
bioRxiv - Immunology 2020Quote: ... and 15% Glycerol from the JCSG Core II (Qiagen) screen ...
-
bioRxiv - Immunology 2021Quote: ... DNAse treatment (15 min at RT; Qiagen, Hilden, Germany) was only conducted in samples used for RNASeq but not in samples used for qPCR analysis ...
-
bioRxiv - Microbiology 2023Quote: ... EasyXtal 15-well Tool crystal plates (Qiagen, Manchester, UK) were set up manually for HAdV-D15 ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Biochemistry 2020Quote: ... the DNA was amplified for 15 cycles and purified (QIAGEN). Three rounds of selection were performed (DNA was quantified by absorbance at 260 nm before each round of binding) ...
-
bioRxiv - Biochemistry 2020Quote: ... 15 g of semi-dry Ni-NTA resin (Qiagen 30450) was weighed out into each of three conical tubes ...
-
bioRxiv - Bioengineering 2022Quote: ... 15 μl of Proteinase K (20 mg/ml; Qiagen #19157) were added to the suspension and incubated at 65°C for approximately one hour ...
-
bioRxiv - Microbiology 2023Quote: ... using the BioSprint 15 DNA Plant Kit (QIAGEN, Hilden, Germany), all according to manufacturers’ instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... 7 and 15 days and purified using RNeasy kit (Qiagen). 1 μg of RNA per condition was used to retrotranscribe into cDNA QuantiTect® Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... 16 µg of plasmid and 15 µL of Effectene (Qiagen). Cells were collected after 48 hours and prepared for the RNA-IP experiment ...
-
bioRxiv - Cancer Biology 2020Quote: Total mRNA was extracted from dissected IL using the RNeasy Micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The tube indices from the QIAseq miRNA NGS 48 Index IL (Qiagen, 331595) were used for library preparation.
-
bioRxiv - Molecular Biology 2024Quote: ... IL]) and homogenized using a stainless steel bead in TissueLyser II (Qiagen, Germany) for 2 min at 30 Hz ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Plant Biology 2019Quote: ... 1x PCR reaction buffer containing 15 mM MgCl2 (Qiagen, Hilden, Germany), 0.2 mM of each dNTP (Fermentas ...
-
bioRxiv - Synthetic Biology 2019Quote: ... was added to a 15 mL polypropylene gravity flow column (Qiagen), storage buffer was allowed to flow through by gravity ...