Labshake search
Citations for Qiagen :
1 - 50 of 1779 citations for IL 1 beta Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and 30 uL/well 1 X lysis buffer (1x Qiagen TCL, 1% beta-mercaptoethanol) was added ...
-
bioRxiv - Immunology 2023Quote: ... ∼1000 macrophages were sorted into 75µL of RLT buffer (Qiagen, containing 1% beta-mercaptoethanol), vortexed for 1 min and immediately frozen (–80°C) ...
-
bioRxiv - Cell Biology 2021Quote: ... + 5% beta-mercaptoethanol using a bead mill (Qiagen). Samples were heated at 95° for 5 minutes to denature proteins ...
-
bioRxiv - Microbiology 2021Quote: ... Tissues were homogenized in Buffer RLT+ beta-mercaptoethanol (Qiagen). Tissue homogenate was then centrifuged through a QIAshredder homogenizer (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... and beta-mercaptoethanol using the TissueLyser II (Qiagen, Australia). DNA was extracted using the AllPrep DNA/RNA Mini Kit following the manufacturer guidelines (Qiagen ...
-
bioRxiv - Biochemistry 2019Quote: ... and CHO-K1 cells respectively using a RNA isolation kit (RNeasy Mini Kit) from Qiagen. cDNAs were synthesized from the isolated RNA using a cDNA synthesis kit (Advantage RT-PCR kits ...
-
bioRxiv - Genomics 2024Quote: ... Homogenization buffer for RNA purification was made by adding 1:100 beta-mercaptoethanol to Buffer RLT (Qiagen, Valencia, CA) and kept on ice until use ...
-
bioRxiv - Plant Biology 2021Quote: ... Fluorescence positive cells were collected in a round-bottom polystylene tube that contains 150 - 200 μl RLT buffer with beta-mercaptoethanol (10 μl / 1 ml RLT buffer, RNeasy micro kit protocol, Qiagen). Cell sorting was performed for about 15 min and collected cells were immediately frozen on dry ice and kept in −80 °C for up to one week ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... per condition or genotype were homogenized in 2-ml Eppendorf tubes containing lysis buffer with 1% beta-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless steel beads (Qiagen #69989) ...
-
bioRxiv - Physiology 2021Quote: ... Shredded bone marrow cells were frozen (−80°C) in RLT buffer (1% beta-mercaptoethanol) until RNA extraction using RNAeasy mini kit (Qiagen). RNA integrity number (RIN ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were lysed using RLT buffer mastermix (10 uL beta-mercaptoethanol : 1 mL RLT) and cells were lysed with RNAeasy micro kit (Qiagen, 74004). RNA quality and quantity was validated using a nanodrop (ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2020Quote: ... RNA samples from heart tissue and HEK and CHO cell pellets were purified using a RNeasy mini kit (Qiagen). RNA was reverse-transcribed to cDNA using an Applied Biosystems High-Capacity RNA-to-cDNA kit (Foster City ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Microbiology 2020Quote: ... coli 10-beta cloning strain were purified using the standard QIAprep protocol (QIAGEN), then delivered to the Pseudomonas strain via previously published electroporation83 or conjugation84 protocols ...
-
bioRxiv - Genetics 2020Quote: ... with beta-actin as a reference gene (QuantiFast SYBR Green PCR Kit; Qiagen) on a Roche LightCycler 480 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Immunology 2019Quote: ... IL-23p19 primers were purchased from QIAGEN and the sequence for osteopontin primers are ...
-
bioRxiv - Immunology 2022Quote: ... Antigen specific B cells were gated with CD19+/IgM-/IgD-/Ghost dye-/PE+/BV605+ and sorted in catch buffer B (Qiagen TCL Buffer + 1% beta mercaptoethanol) by one cell per well in a 96 well plate ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Genomics 2021Quote: ... Then 37.5μl of beta-mercaptoethanol (0.375% final) and 10μl RNAse A (Qiagen® 100mg/mL) were added ...
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed in RLT (with 143mM beta-mercaptoethanol) and RNA purified using the RNeasy kit (Qiagen). 0.8-2μg of RNA were reverse transcribed using the High-Capacity cDNA reverse transcription kit and quantitative real-time PCR was carried out with the ViiA 7 Real-time PCR system (both Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Systems Biology 2020Quote: ... IL-8 ELISA was performed according to manufacturer instructions (Qiagen).
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted in RLT buffer supplemented with beta-mercaptoethanol and processed with the RNeasy Micro Kit (QIAGEN) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Immunology 2021Quote: ... Cells were lysed in RLT buffer with Beta-mercaptoethanol and RNA was extracted using Qiagen RNEasy kit (Qiagen; #74134). Extracted RNA was then converted to cDNA using the one-step qSCRIPT cDNA solution ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... from rraga mutants or wildtype siblings were sorted using BD FACSAria II directly into lysis buffer (RLT+beta-mercaptoethanol) from Qiagen RNeasy Micro Kit (74004) ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from INS-1 and human islets 48 hours post transfection using RNeasy cleanup kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Neuroscience 2023Quote: ... HEK-beta cells were transiently transfected with WT or variant NaV1.2 (2 µg) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.).
-
bioRxiv - Synthetic Biology 2023Quote: ... Phoenix-Eco or Phoenix-Eco alpha-V beta-3 were transfected with LZRS-vector constructs using Effectene transfection reagent (Qiagen, 301425) as follows ...
-
bioRxiv - Cancer Biology 2020Quote: Total mRNA was extracted from dissected IL using the RNeasy Micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The tube indices from the QIAseq miRNA NGS 48 Index IL (Qiagen, 331595) were used for library preparation.
-
bioRxiv - Molecular Biology 2024Quote: ... IL]) and homogenized using a stainless steel bead in TissueLyser II (Qiagen, Germany) for 2 min at 30 Hz ...
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...