Labshake search
Citations for Qiagen :
1 - 50 of 10000+ citations for Human Oligodendrocyte transcription factor 1 OLIG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Transcription factor prediction was performed with Ingenuity Pathway Analysis (Qiagen), iRegulon (Janky et al ...
-
bioRxiv - Bioengineering 2019Quote: ... Transcription kit (Qiagen) and prepped for RT-PCR using PIPETMAX (Gilson ...
-
bioRxiv - Bioengineering 2022Quote: ... Transcription Kit (QIAGEN). qPCR was performed on the StepOne™ system (Applied Biosystems ...
-
bioRxiv - Genomics 2019Quote: ... Transcription kit (Qiagen). PCR reactions were done with the DyNAzyme II DNA Polymerase (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Transcription Kit (QIAGEN), quantitative PCR was performed on the StepOne™ system (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... Transcription Kit (Qiagen), followed by qPCR with QuantiNova SYBR Green PCR Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Transcription Kit (Qiagen). Detailed information about designing a specific arsM gene primer set ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Transcription Kit (QIAGEN). Manual specifications were followed ...
-
bioRxiv - Cancer Biology 2022Quote: A ready-to-transduce transcription factor-responsive lentiviral reporter system (CCS-1022L, QIAGEN) was used to generate a stable cell line ...
-
bioRxiv - Physiology 2021Quote: ... Reverse transcription of total RNA (1 μg) was done with QuantiTect Reverse Transcription kit (Qiagen), and cDNA quantified using LC Fast start DNA Master SYBR Green I Mix (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse Transcription was performed on 1 µg of RNA using a QuantiTect Reverse Transcription Kit (Qiagen), and qPCR was performed using a QuantiNova SYBR Green PCR kit (Qiagen) ...
-
bioRxiv - Genomics 2023Quote: ... Reverse transcription was performed from 1 µg RNA using the Quantitect Reverse Transcription Kit (QIAGEN, Manchester, UK) and cDNA was diluted to 10 ng/µl equivalent before use in qPCR ...
-
bioRxiv - Developmental Biology 2022Quote: OPCs and immature oligodendrocyte cultures or primary cell isolations were lysed and processed using the miRNeasy Mini kit (Qiagen, 217004) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Reverse transcription was performed using QuantiTect Reverse Transcription Kit (QIAGEN). Real-time PCR was performed using FastStart Universal SYBR Green Master (Rox ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription was performed using QuantiTect Reverse Transcription kit (Qiagen). Human cell motility RT2 profiler PCR Array (Qiagen ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... followed by reverse transcription using QuantiTect Reverse Transcription Kit (Qiagen) and PCR using primers that flank the targeted exons ...
-
bioRxiv - Developmental Biology 2022Quote: ... Reverse transcription was done using QuantiTect Reverse Transcription Kit (Qiagen). qRT-PCR was performed using AmpliTaq Gold® DNA Polymerase (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription was performed with 1 µg of the isolated RNA using the QuantiTect Reverse Transcription Kit (Qiagen). mRNA expression levels of ARTD3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reverse transcription reactions were performed with 1 μg of total RNA with the QuantiTect Reverse Transcription kit (Qiagen). Gene expression was measured using TaqMan™ master mix (Thermofisher ...
-
bioRxiv - Genomics 2023Quote: ... 1 μg total RNA was subjected to reverse transcription with a QuantiTect reverse transcription kit (Qiagen, Germantown, MD). The resulting cDNA and Fast SYBR green master mix (Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... Reverse transcription was performed with 1 µg of template RNA using the Qiagen QuantiTect reverse transcription kit (Qiagen) in a Bio-Rad T100TM Thermal Cycler (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... Omniscript Reverse Transcription Kit (Qiagen) was used for cDNA synthesis ...
-
bioRxiv - Biochemistry 2020Quote: ... Transcription Kit (QIAGEN, Venlo, Netherlands). Quantitative expression analysis was performed using an ABI PRISM 7900HT Sequence Detector (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... QuantiNova Reverse Transcription Kit (Qiagen) was used with 1 µg of total RNA for each sample ...
-
bioRxiv - Neuroscience 2023Quote: ... QuantiTect Reverse Transcription Kit (Qiagen) was used for genomic DNA removal and cDNA synthesis according to the provided instructions ...
-
bioRxiv - Microbiology 2023Quote: ... QuantiTect reverse transcription kit (QIAGEN) was used for cDNA synthesis from 1 µg RNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... The transcription factor prediction was performed using i-cisTarget20 and the upstream regulator function by QIAGEN Ingenuity Pathway Analysis.21 Differentially expressed genes (DEGs ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription was conducted using QuantiTect® Reverse Transcription Kit (Qiagen,). Real-time PCR was performed using the Custom RT² Profiler PCR Array according to the manufacturer’s instructions (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reverse transcription was performed using the Quantitect Reverse Transcription Kit (Qiagen). cDNA was detected using Power Up SYBR Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using random and HAstV1-specific reverse primers ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using virus-specific reverse primers for SINV (GTTGAAGAATCCGCATTGCATGG ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse transcription was performed using the Quantitect Reverse Transcription Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... and reverse transcription using a QuantiTet Reverse Transcription kit (205311; QIAGEN). Relative quantification of genomic DNA or cDNA was performed on a 7900HT Fast Real-Time PCR System (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... Reverse transcription was performed with the Quantitect reverse transcription kit (Qiagen). qRT-PCR was conducted in triplicate using Quantitect SYBR Green PCR reagent (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: ... and reverse transcription performed using QuantiTect Reverse transcription kit (Qiagen, Germany). All quantitative real time rtPCR assays were carried out three times using TaqMan® universal master mix II with UNG (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... Reverse transcription was performed using the QuantiTect Reverse Transcription Kit (Qiagen). 1 μg total RNA was used in each reaction ...
-
bioRxiv - Microbiology 2022Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using virus-specific reverse primers for SINV (GTTGAAGAATCCGCATTGCATGG) ...
-
bioRxiv - Cell Biology 2022Quote: ... After reverse transcription with the Quantitect reverse transcription kit (Qiagen, 205311), SYBR green qPCR was performed (Takyon ...
-
bioRxiv - Cell Biology 2024Quote: ... Retro-transcription was conducted using a Quantitect Reverse Transcription kit (Qiagen) with a first step of genomic DNA elimination ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 µg RNA was reverse transcribed using QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription kits (RT2 First Strand Kit; Qiagen) were used for cDNA synthesis ...
-
bioRxiv - Neuroscience 2019Quote: ... and reverse transcription was performed with the Quantinova reverse transcription kit (Qiagen); reaction mixtures lacking reverse transcriptase was used as negative control ...
-
bioRxiv - Neuroscience 2020Quote: ... Reverse transcription was performed via the miScript II reverse transcription kit (Qiagen). qPCR was performed using the RotorGeneQ thermocycling system (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: Reverse transcription was performed using the QuantiTect® Reverse Transcription Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse transcription was performed using a QuantiTect Reverse Transcription Kit (Qiagen, 205311) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2021Quote: ... Reverse transcription reaction was performed with the miScript Reverse Transcription kit (QIAGEN), and cDNA was amplified by real-time PCR with a miScript SYBR Green kit (QIAGEN) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse transcription was carried out with QuantiTect Reverse Transcription Kit (Qiagen) with indicated primers (Table 3 ...
-
bioRxiv - Bioengineering 2023Quote: ... before reverse transcription into cDNA using QuantiTect Reverse Transcription Kit (Qiagen, Germany). qPCR was performed with PowerTrackTM SYBR Green Master Mix kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... Retro-transcription into cDNA was performed using QuantiTect Reverse Transcription kit (Qiagen).
-
bioRxiv - Neuroscience 2020Quote: ... Transcription Kit (Qiagen GmbH, Hilden, Germany) and then used for qPCR with ORA qPCR Green ROX L Mix (HighQu ...