Labshake search
Citations for Qiagen :
1 - 50 of 10000+ citations for Human Hypoxia inducible factor 3 alpha HIF3A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... to perform RT² Profiler™ PCR Array Mouse Hypoxia Signaling Pathway (Qiagen) real-time PCR in Stratagene MX3000p qPCR system under these cycling conditions ...
-
bioRxiv - Immunology 2019Quote: ... Human RAC2 3’UTR was amplified with One Step Ahead RT-PCR kit (Qiagen) from human mRNA using the following primers RAC2 3’UTR+ ...
-
bioRxiv - Biochemistry 2021Quote: ... doxycycline-inducible HEK-293 cells was isolated using the RNeasy Mini kit (Qiagen, Germantown, MD, USA). The isolated RNA was processed via reverse-transcription (RT)-PCR and Ψ (percent spliced in ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from Doxycycline-inducible p53 expressing RPETert cells (treated with or without doxycycline) using the RNeasy kit (QIAGEN). 500 ng RNA was used for cDNA synthesis using the iScript cDNA Synthesis Kit (BIO-RAD ...
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from resulting HeLa Kyoto and RPE1 inducible cell lines (QIAmp DNA Blood Mini Kit Qiagen #51106) and sequenced through the S357 mutation site (Eurofins ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Phoenix-Eco or Phoenix-Eco alpha-V beta-3 were transfected with LZRS-vector constructs using Effectene transfection reagent (Qiagen, 301425) as follows ...
-
bioRxiv - Cancer Biology 2023Quote: The resulting inducible cell lines were verified to be correct by extracting genomic DNA (QIAmp DNA Blood Mini Kit Qiagen #51106) and sequencing through the S284 mutation site (Eurofins) ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 3) human iPSC-derived neurons was prepared using miRNeasy Micro Kit (Qiagen Cat. 217084), based on manufacturer’s procedures ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, PSEN1A246E, and PSEN1H163R (replicates, n = 3) human iPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen, Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting lists of transcripts differentially expressed or translated in response to hypoxia were displayed and analyzed using BioVenn web application (Hulsen et al., 2008) and Ingenuity Pathway Analyses (QIAGEN).
-
bioRxiv - Physiology 2020Quote: ... or the QuantiTect PCR Kit with self-designed primers for neuronal factors (Qiagen, Germany) (Supplementary Table 3) ...
-
bioRxiv - Bioengineering 2021Quote: ... supernatant was collected and Factor Xa was removed with Factor Xa Removal Resin (QIAGEN). Endotoxin was removed using endotoxin removal resin and Atsttrin purity was determined by SDS-PAGE and reverse phase high performance liquid chromatography (HPLC).
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...
-
bioRxiv - Genetics 2021Quote: Multi-array ELISA was performed using the Multi-Analyte ELISArray Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... encoded in the inducible bacterial expression plasmid pRK172 and purified by maxi-prep (Qiagen), was transformed into chemically-competent BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Immunology 2023Quote: ... RNA from human PBMCs was isolated using RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Immunology 2020Quote: ... and prepared the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). 10ng purified RNA was used for the NGS libraries ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cloned plasmid was amplified in DH5-Alpha cells and purified with QIAfilter™ Plasmid Maxi Kit (Qiagen, catalogue number 12243). Plasmid concentration was measured using Qubit (Thermofisher ...
-
bioRxiv - Cancer Biology 2019Quote: ... according to the manufacturer’s protocol with inducible dual-luciferase and Renilla estrogen response element (ERE) constructs (Qiagen) using FuGENE HD transfection reagent (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... astrocytes and human brain tissue using the RNeasy Mini kit (Qiagen) and reverse transcribed using the High-Capacity RNA-to-cDNA kit (ThermoFisher Scientific) ...
-
bioRxiv - Plant Biology 2022Quote: ... Hoko-3 using a Genomic-tip kit (Qiagen, Hilden, Germany). Library preparation was performed using SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA from the control human TSCs as well as WWTR1-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, 74104) per the manufacturer’s protocol with on column DNase digestion ...
-
bioRxiv - Genetics 2022Quote: RNA from human ileal biopsies was extracted using RNeasy Mini Kit (Qiagen). 500 ng of RNA was reverse transcribed to cDNA using TaqMan Reverse Transcription kit (#N8080234 ...
-
bioRxiv - Molecular Biology 2019Quote: Human islet RNA was extracted using the Qiagen RNeasy Kit (Qiagen; #74106) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... human sputum cells or mouse lung tissue using an RNeasy kit (Qiagen). 2μg was utilised for cDNA synthesis using the Omniscript RT kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA from the control human TSCs as well as GATA2-KD and GATA3-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, Germantown, MD) per the manufacturer’s protocol with on-column deoxyribonuclease digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Genomics 2019Quote: ... and human genomic DNA (extracted from cells with DNeasy Blood & Tissue Kit, Qiagen). One guide was used with the plasmid ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were prepared using the QIASeq Human Comprehensive Cancer Panel Kit (Qiagen #333515) and sequenced on an Illumina HiSeq 2500 or NovaSeq 6000 ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted from human cells with an RNeasy Mini kit (Qiagen). Northern blot was performed as described previously (Tafforeau et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was extracted from human thyroid tissues using miRNeasy Mini kit (Qiagen) according to the manufacturer’s instructions and as described [26] ...
-
bioRxiv - Neuroscience 2023Quote: ... Human rRNA depletion was performed using the QIASeq FastSelect kit (Qiagen, Hilden, Germany). RNA sequencing library preparation used NEBNext Ultra II RNA Library Prep Kit for Illumina following the manufacturer’s recommendations (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: DNA from human stool samples was extracted with DNeasy PowerSoil Pro kit (Qiagen) according to the manufacturer’s instruction ...
-
bioRxiv - Evolutionary Biology 2022Quote: Total RNA for human TSCs was extracted using RNeasy Micro kit (Qiagen, 74004) with on-column DNase digestion ...
-
bioRxiv - Synthetic Biology 2023Quote: ... or primary human cells were extracted using the Qiagen RNeasy Micro Kit (Qiagen). cDNA was produced using the SuperScript IV VILO cDNA Synthesis Kit (Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... A 1:3 mixture of a QuantiFast SYBR Green PCR Kit (Qiagen) and a FastStart SYBR Green Master (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... After 24 hours the media was removed for ELISA and the cells were lysed and RNA extracted (RNeasy Mini Kit, Qiagen).