Labshake search
Citations for Qiagen :
1 - 50 of 10000+ citations for Human Cytochrome P450 Family 4 Subfamily F Member 2 CYP4F2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: DNA was extracted from all family members from whole blood using Puregene chemistry (Qiagen). Exome capture was undertaken in both affected individuals using the SureSelect 50 Mb All Exon Kit v3 (Agilent ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA was isolated from various tissue samples collected from patients and their family members with a Gentra DNA extraction kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... GGA family member and interactor targeting siRNAs (Oligo IDs indicated in Fig. S1A) and control siRNA were purchased from Qiagen. Before plating MDA-MB-231 cells on CSMA ...
-
bioRxiv - Genomics 2023Quote: ... Genomic DNA for Family 1100 and Family 2100 was extracted with the MagAttract HMW DNA Kit (Qiagen) from whole blood samples of individuals enrolled in a human subjects research protocol approved by the New York University Grossman School of Medicine Institutional Review Board.
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: Genomic DNA from Pitohui uropygialis meridionalis (Family Oriolidae) blood and tissue was extracted using DNeasy kits (Qiagen) to create whole genome sequence libraries for the poisonous Pitohui birds ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR for individual miR-17∼92 members was performed using miRCURY LNA probes and miRCURY LNA SYBR Green PCR Kit (Qiagen).
-
bioRxiv - Microbiology 2022Quote: ... Cytochrome b products were excised and purified from the gel using a commercial kit (QIAquick Gel Extraction Kit, Qiagen, Germany), followed by purification of eluted DNA using AMPure XP Magnetic Beads (1X ...
-
bioRxiv - Genomics 2019Quote: Total RNA was extracted from leaf tissues collected from homozygous resistant and susceptible families and the two parents using the RNeasy Plant Mini Kit (QIAGEN) according to the manufacture’s instruction ...
-
bioRxiv - Immunology 2019Quote: RNA was extracted from 2×106 human PMNs using the RNeasy Mini Kit (Qiagen) as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Plant Biology 2021Quote: ... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
bioRxiv - Developmental Biology 2022Quote: ... Gene expression of different fos family genes in zebrafish was analyzed using Quantitect™ Primer Assays (Qiagen) for each individual gene – fosaa ...
-
bioRxiv - Genetics 2024Quote: ... 2 or 4 days and genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). Bisulfite converted DNA libraries were prepared using the Accel-NGS Methyl-Seq DNA library kit (SWIFT BIOSCIENCES) ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA from magnetically purified human NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 4) hiPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from a SARS-CoV-2 Omicron BA.1 clinical isolate (SARS-CoV-2/human/USA/CA-CDC-4358237-001/2021) (GenBank: OM264909.1) using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). The complete wild-type Omicron genome was then reverse transcribed via RT-PCR with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Those included UniSpike 2 and 4 from the QIAGEN RNA Spike-In Kit (Cat. No.: 339390, QIAGEN, Hilden, Germany), which were used to monitor RNA isolation efficacy ...
-
bioRxiv - Genetics 2021Quote: Multi-array ELISA was performed using the Multi-Analyte ELISArray Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Microbiology 2021Quote: A total of 600 μL (three × 200 μL) of day 4 SARS-CoV-2 culture supernatant was used as input into the RNeasy Mini Kit (Qiagen) for RNA extraction with minor modifications ...
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA of 2 – 4 dpf zebrafish embryos was extracted using Trizol reagent and purified using the RNeasy Mini Kit (Qiagen), according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from approximately 100 EBs (differentiation day 2 and 3) or 25 EBs (differentiation day 4 and 5) using RNeasy Mini kit (Qiagen). 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged at 5000 g for 2 hours at 4 °C and the pellet was collected for DNA extraction with a DNeasy PowerSoil kit (Qiagen, Germany). The sediment from Lime Blue was collected with a freeze core (modified from Stocker and Williams ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from OSU-CLL cells (1.5e6 cells/mL) treated with DMSO or SpiD3 (1, 2 μM; 4 h) using the miRNeasy Mini Kit (Qiagen; Hilden, Germany) per manufacturer instructions and processed using the Universal Plus mRNA-Seq with NuQuant kit (Tecan ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Immunology 2023Quote: ... RNA from human PBMCs was isolated using RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 100,000 g (31,000 RPM) for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen, Germantown, MD) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4) DNeasy Plant Mini Kit (QIAGEN®) combined with the InhibitEx Buffer step from the QIAamp DNA Stool Mini Kit to improve inhibitor removal ...
-
bioRxiv - Immunology 2020Quote: SARS-CoV-2 ELISA was developed in-house using His tagged proteins bound on Ni-NTA HisSorb Strips or Plates (Qiagen). ELISA assay on mouse sera were performed with His-tagged SARS-CoV-2 full length Spike protein (produced in baculovirus ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Microbiology 2021Quote: Cellular total RNA was prepared from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Genomics 2021Quote: ... Quantification of ACE2 transcript levels was performed by preparing total RNA from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Molecular Biology 2022Quote: Viral RNA was extracted from serially diluted and the 4 different media SARS-CoV-2 samples using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH, Hilden, Germany). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... astrocytes and human brain tissue using the RNeasy Mini kit (Qiagen) and reverse transcribed using the High-Capacity RNA-to-cDNA kit (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease73 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Genomics 2019Quote: ... the Qiagen PowerMag kit (Qiagen, Cat# 27500-4-EP) was used for robot extractions while the Qiagen DNeasy PowerSoil kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA from the control human TSCs as well as WWTR1-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, 74104) per the manufacturer’s protocol with on column DNase digestion ...