Labshake search
Citations for Qiagen :
1 - 50 of 2462 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... by centrifugation (200 x g for 5 min at 25°C. Whole RNA was isolated using the Qiagen RNeasy kit (Qiagen) according to the manufacturer’s description ...
-
bioRxiv - Genomics 2023Quote: ... The bead-bound gDNA was isothermally amplified for 3 hours at 30 °C then 10 minutes at 65 °C using a miniaturised (1/5 vols) Repli-g Single-Cell assay (Qiagen). The amplified gDNA was cleaned up with 0.8 × vols Ampure XP and 80 % ethanol ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were harvested (1×106) by centrifugation (200 x g for 5 min at 25°C. Whole RNA was isolated using the Qiagen RNeasy kit (Qiagen) according to the manufacturer’s description ...
-
bioRxiv - Cell Biology 2024Quote: ... a second transfection of a 0.6 μg plasmid encoding either the C-terminal GFP11 tagged M2tail(368-466) or M2 receptor was performed using the Effectene Transfection Reagent (Qiagen). After washing each well with 2 mL PBS ...
-
bioRxiv - Immunology 2021Quote: ... Following the manufacturer’s instructions RNA was reverse-transcribed in a 20 μl reaction volume (42°C, 30 min; 95°C, 5 min) using a QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). cDNA was then amplified using a SYBR Green I Master mix (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...
-
bioRxiv - Microbiology 2024Quote: ... 37°C in 5% CO2 and purified with a RNeasy mini kit (Qiagen) according to the protocol for Gram-positive bacteria ...
-
bioRxiv - Genetics 2024Quote: ... and a negative control region within a regulatory region of the estrogen receptor substrate 1 (ESR1) without a predicted G4 motif (91) were PCR-amplified with HotStar Taq Polymerase (Qiagen). The PCR fragments were cleaned-up with Promega ReliaPrep DNA concentration kit and eluted in dH2O ...
-
bioRxiv - Microbiology 2019Quote: ... 4A-C and 5A-C were lysed in buffer RLT (Qiagen). The cell solution/suspension? was homogenised using QIAshredder columns (Qiagen ...
-
bioRxiv - Developmental Biology 2024Quote: ... using a touchdown PCR for the first 10 cycles from 72 to 60 followed by 35-40 cycles at the proper annealing temperature (Tm −2°C) and extension 68°C 30sec/Kb or 72°C 15sec/Kb and purified using a PCR purification KIT (Qiagen). Equimolar amounts of PCR products were mixed and a PCR was made with a primeSTAR GXL DNA polymerase (Takara Bio ...
-
bioRxiv - Genetics 2019Quote: ... 59°C for 180 s and 72°C for 30 s (Qiagen Multiplex kit handbook ...
-
bioRxiv - Cell Biology 2019Quote: ... incubated with Trizol for 5 min at 4°C and homogenized using TissuLyserTM (Qiagen) for 5 min at 50 Hz ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Cancer Biology 2021Quote: ... Chemokine expression was quantified using RT2 Profiler PCR array for mouse chemokines/cytokines (Qiagen PAMM-150ZA, 330231) with data analysis performed using the Qiagen online tool PCR Array data analysis Web portal (https://www.qiagen.com/gb/resources/resourcedetail?id=20762fd2-8d75-4dbe-9f90-0b1bf8a7746b&lang=en) ...
-
bioRxiv - Genetics 2021Quote: ... and end-point PCRs were performed following 34 cycles (94 C 30 sec, 58 C 30 sec, 72 C 1 min) using the HotStarTaq Plus DNA polymerase (Qiagen, Canada) according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2022Quote: ... Initial gene expression profiling was performed using the 96-well Human Cytokines & Chemokines RT2 Profiler PCR Array (PAHS-150ZC, Qiagen) according to manufacturer instructions ...
-
bioRxiv - Immunology 2021Quote: ... MR1-Tet+ Vα7.2+ CXCR5+ cells were sorted into TRIzol Reagent (Qiagen). Total RNA was isolated using the RNeasy Micro kit and cDNA synthesized a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Genomics 2021Quote: ... and grown at 30°C or 37°C for the plasmid DNA preparation (Qiagen miniprep). The resulting plasmids were sequence-verified using Sanger sequencing (Genewiz).
-
bioRxiv - Neuroscience 2023Quote: ... The remaining cells were pelleted at 1000 x g for 10 minutes at 4°C and lysed in 350 µL of Buffer RLT (Qiagen) supplemented with 3.5 µL of 2-β mercaptoethanol (#444203 ...
-
bioRxiv - Microbiology 2024Quote: ... Lysates were centrifuged for 30 min at 30000 x g in 4 °C and the resulting supernatants were gently mixed with Ni-NTA Agarose beads (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... Total RNA was extracted from the supernatant (12,000 x g for 10 min at 4°C) of centrifuged tissue homogenate using an RNeasy Mini Kit (Qiagen, USA). The extracted total RNA was used for single-strand cDNA synthesis ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was added to the Human Toll-like receptor signaling pathway RT2 Profiler PCR array (Qiagen) and run on an iCycler MyiQ (Bio-Rad) ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was incubated for 2h at 4°C with 5 ml of Ni-NTA agarose (Qiagen) pre-equilibrated in wash buffer 1 WB1 ...
-
bioRxiv - Microbiology 2020Quote: ... samples were defrosted and incubated in 1 ml of RNAprotect cell reagent (Qiagen, 5 min, 25°C). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... RT2 Profiler™ PCR array mouse cytokines & chemokines (Qiagen) was used according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The RT2 Profiler “Inflammatory cytokines and receptors” and “Human innate and adaptive response” arrays PCR Arrays (Qiagen) were performed according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... The suspension was spun down at 16,000 r.c.f at 4 °C for 30 min and the supernatant was applied 5 ml Ni-NTA resin (Qiagen)/ L culture medium ...
-
bioRxiv - Plant Biology 2022Quote: ... Genomic DNA was eluted from the column using 5 mL of prewarmed (50°C) QF Buffer (Qiagen, Germany). DNA was precipitated by adding 0.7 volumes of isopropanol ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Protein digestion was performed on the eluted DNA samples at 50°C for 30 minutes (Qiagen Protease mix). ChIP DNA was purified using Sera-Mag beads (Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... The lysate was clarified by centrifugation at 20,000 x g for 45 minutes at 4°C and incubated with Ni-NTA agarose resin (Qiagen, catalogue number: 30230) pre-equilibrated with lysis buffer for 2 hours at 4°C ...
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lysates were then incubated at 95°C for 5 min and filtered using a QIAshredder homogenizer (Qiagen, 79656). The extracted proteins were analyzed using 5–20% gradient sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE ...
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was 0.2 µM filtered and was incubated overnight at 4°C with 5 mL of Ni-NTA beads (Qiagen). XXX
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was extracted from plant cells and Hi-C libraries were prepared using EpiTect Hi-C Kit (Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant both N-and C-terminally His-tagged proteins were purified using a Ni-NTA Superflow cartridge (1ml, Qiagen) and the Fast Protein Liquid Chromatography (FPLC ...
-
bioRxiv - Microbiology 2024Quote: ... Flag-SHOC2 was cleaved from 6X-His-MBP by incubating 37 mg purified protein with 0.65 mg TEV protease at 4°C overnight followed by affinity purification using Nickel affinity resin (Qiagen) where cleaved Flag-SHOC2 was collected in the flow-through.
-
bioRxiv - Evolutionary Biology 2022Quote: ... pH 5.8) under long day condtions (16h light) at 24 °C (day) 22 °C (night) using the DNeasy Plant Kit (Qiagen). ONSEN copy numbers were determined by qPCR using 12 ng total DNA using the KAPA SYBR FAST master mix universal on a C1000 Touch (Bio-Rad ...
-
Dimeric prion protein ligand activates Adgrg6 but does not rescue myelinopathy of PrP-deficient micebioRxiv - Neuroscience 2020Quote: ... The temperature was increased from 25 °C to 95 °C at 3 °C per minute and fluorescence was measured at 610 nm in a Rotor-Gene Q thermocycler (Qiagen). The experiment was performed in technical triplicates ...
-
bioRxiv - Molecular Biology 2019Quote: ... were frozen at −80°C and subsequently digested at 56°C overnight by Proteinase K (10mM in Tris-HCl, 19133, Qiagen). To account for potentially differential cell proliferation rate between treatments all the ATP quantifications were normalized to DNA content in the same samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNAs were purified from 3 mL overnight cultures grew at optimum temperature (30 °C or 37 °C) by Dneasy Blood & Tissue Kits (QIAGEN). Additionally ...
-
bioRxiv - Microbiology 2023Quote: ... Eluates were then treated with Proteinase K (45°C, 1400rpm, 4h) and RNaseA (37°C, 1400rpm, 30min) before cleanup using MiniElute PCR Purification kit (Qiagen). Purified DNA together with input samples before immunoprecipitation were amplified using qPCR SyBr green mix (PCR Biosystems ...
-
bioRxiv - Genomics 2019Quote: ... and stored at −20°C until midiprepped (Qiagen) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...