Labshake search
Citations for Qiagen :
1 - 50 of 1750 citations for HCC 1 CCL14 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: Genomic DNA was extracted from HCC cell cultures using DNeasy Blood & Tissue kit(Qiagen) for bisulfite-sequencing assay according to the manufacturer’s protocols.
-
bioRxiv - Cancer Biology 2021Quote: Mouse-derived xenograft HCC tumors were homogenized in RIPA buffer using metal beads and the LT TissueLyser (Qiagen). Samples were sonicated (Branson Sonifier 3310s ultrasound probe ...
-
bioRxiv - Cancer Biology 2021Quote: ... Xenograft and HCC mouse samples were homogenized in RIPA buffer using metal beads and the LT tissuelyzer (Qiagen). All samples were sonicated (ultrasound probe ...
-
bioRxiv - Cell Biology 2022Quote: RNA was extracted from HCC cells cultured in DMEM + 10% FS for 24 hours using a Qiagen RNeasy Plus Mini Kit (Qiagen #74134) with an additional on column DNA digestion using Qiagen TURBO DNase (Qiagen #AM2238 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from INS-1 and human islets 48 hours post transfection using RNeasy cleanup kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA from the control human TSCs as well as WWTR1-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, 74104) per the manufacturer’s protocol with on column DNase digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from 1 mL of each human plasma sample using the DNeasy Blood and Tissue kit (Qiagen, 69504, Hilden, Germany) according to the manufacturer protocol and recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA from the control human TSCs as well as GATA2-KD and GATA3-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, Germantown, MD) per the manufacturer’s protocol with on-column deoxyribonuclease digestion ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides for siRNA included: human βPix (synthesized by Qiagen), human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Cell Biology 2019Quote: ... Human primers were pre-validated Quantitect primers (Qiagen, Manchester, UK). Comparative quantification normalised target gene mRNA to β-actin (ACTB ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from human samples was extracted with PowerSoil Pro (Qiagen) on the QiaCube HT (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... the human Stress & Toxicity PathwayFinder RT2 Profiler™ technology (Qiagen), assessing expression of 84 stress response-related genes ...
-
bioRxiv - Immunology 2020Quote: ... Mouse and Human IFN I RT2 Profiler PCR Arrays (Qiagen) were performed and relative expression determined using the ∆∆CT method and normalized for 5 housekeeping genes according to manufacturer’s guidance.
-
bioRxiv - Cancer Biology 2022Quote: ... individual Human SHANK3 siRNA_2 (Cat. no. S100717710 Hs_SHANK3_2 siRNA, Qiagen) and individual ON-TARGETplus Human SHANK3 siRNA_7 (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, Catalog Number ...
-
bioRxiv - Molecular Biology 2023Quote: A siRNA library targeting all human kinases (Qiagen, Hilden, Germany) was utilized ...
-
bioRxiv - Immunology 2023Quote: ... RNA from human PBMCs was isolated using RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... astrocytes and human brain tissue using the RNeasy Mini kit (Qiagen) and reverse transcribed using the High-Capacity RNA-to-cDNA kit (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: The Human Cancer Stem Cells RT² Profiler PCR Array from Qiagen was used to profile the expression of 84 genes linked to cancer stem cells (CSCs ...
-
bioRxiv - Cancer Biology 2022Quote: Human EMT qPCR arrays were purchased from Qiagen (Cat. #: PAHS-021Z), performed as described using RNA from PDX mammary tumors grown in SOFT and STIFF Col1/rBM hydrogels ...
-
bioRxiv - Cell Biology 2022Quote: ... His- tagged human UHRF1 was purified using Ni-NTA sepharose resin (Qiagen). Recombinant E1 (His-UBE1) ...