Labshake search
Citations for Qiagen :
1 - 50 of 842 citations for Glypican 3 GPC3 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Human RAC2 3’UTR was amplified with One Step Ahead RT-PCR kit (Qiagen) from human mRNA using the following primers RAC2 3’UTR+ ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells and MEFs were transiently transfected with PolyFect (Qiagen) and Lipofectamine 3000 (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transfection of HEK293 cells was performed using Attractene transfection reagent (Qiagen) by the fast-forward transfection approach following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... or EGFP-Lin52 fusions into HEK293-GP cells with Effectene (Qiagen) for transduction as described previously (58).
-
bioRxiv - Cell Biology 2021Quote: ... HEK293 or U20S cells with the RNeasy Mini-kit (Qiagen, Hilden, Germany) and quantified with a NanoDrop 8000 spectrophotometer (Thermo-Fisher) ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Biochemistry 2021Quote: Messenger RNA was extracted from HEK293 cells using an RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions and used as the template to synthesise complementary DNA (cDNA ...
-
bioRxiv - Biophysics 2024Quote: The HEK293 stable cell lines were generate by a transfection with Effectene (Qiagen) and 1µg plasmid (pmCherry-N1-hERG-WT and -A561V ...
-
bioRxiv - Immunology 2020Quote: Total RNA of IFN-α2 treated HEK293 cells was purified using RNeasy columns (Qiagen) with on-column DNase I digestion ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Neuroscience 2020Quote: ... HEK293 cells were transfected with hTRPM3α2-GFP or its mutants using the Effectene reagent (Qiagen). Cells were loaded with 1 μM fura-2 AM (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 3) human iPSC-derived neurons was prepared using miRNeasy Micro Kit (Qiagen Cat. 217084), based on manufacturer’s procedures ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, PSEN1A246E, and PSEN1H163R (replicates, n = 3) human iPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen, Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 293A cells were transfected with the plasmid of pCDNA3.1-ACE2 (human)-3×FLAG (MiaoLing Plasmid Platform, China) using polyfect (QIAGEN, West Sussex, UK) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Cell Biology 2019Quote: ... by retrotranscription of RNAs from HeLa and HEK293-T cells using the QuantiTect Reverse Transcription kit (Qiagen) followed by PCR-mediated amplification and plasmid insertion with the in-Fusion cloning kit (Clontech) ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA was extracted from the parental and knockout HEK293 cells using QIAamp DNA mini kit (QIAGEN) and PCR amplified with primers located ~500-600 bp from the sgRNA target site ...
-
bioRxiv - Genetics 2023Quote: The extraction of total RNA from HEK293 stable cell lines was isolated by RNeasy mini kit (QIAGEN), and cDNA was reversed with Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated from HEK293 cells using the QIAshredder and RNeasy Mini kit (Qiagen, 79654 and 74104, respectively). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: HEK293 cells were seeded in 15 cm plates and transfected after 24h according to manufacturer protocols (Effectene, Qiagen) using 5 µg of plasmid DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA from mouse tissues and cultured HEK293 cells were extracted using DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD). Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Physiology 2021Quote: RNA was isolated from the three HEK293 cell lines after 48 h in culture using the RNeasy Protect Mini Kit (catalog #74124, Qiagen). After reverse transcription (Super-Script II reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were transfected with plasmids (WT mGlu1, the mGlu1 mutants, or the control vector) using SuperFect transfection reagent (Qiagen) or Viafect (promega ...
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Approximately 5×106 HEK293 cells were used to isolate RNA with the All Prep RNA/DNA Mini Kit (Qiagen; 80204). cDNA was generated using 1μg of RNA with oligo(dT ...
-
bioRxiv - Cell Biology 2024Quote: ... into 4 million HEK293-GP cells in 300 µl Buffer EC with 16 µl Enhancer and 60 µl Effectene Transfection Reagent (Qiagen 301425) (Morgenstern and Land ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...
-
bioRxiv - Cell Biology 2019Quote: ... KIF4A siRNA 5’-CAGGTCCAGACTACTACTC-3’ against the 3’-UTR was obtained from QIAgen, and an optimised siRNA pool for KIF22 (KID ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Cell Biology 2019Quote: siRNAs used were as follows: Kif5b#3 (target sequence 5′-CAGCAAGAAGTAGACCGGATA-3′; Qiagen SI00176050), Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′ ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...