Labshake search
Citations for Qiagen :
1 - 50 of 145 citations for Forkhead Box L1 FOXL1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... coli codon optimized L1 ORF0 sequence generated by Miniprep (Qiagen). 8nM EN WT and inhibitors or vehicle were incubated at room temperature for 1 hour before adding 2nM plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
bioRxiv - Neuroscience 2023Quote: ... L1-L5 mouse DRG was homogenized with an RNeasy Mini Kit (Qiagen, Valencia, CA) using on-column DNase-I digestion according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Approximately 60 homozygous males from each E-box deleted fly line were disrupted in lysis-buffer (Buffer AL, Qiagen) using a motorized microtube homogenizer ...
-
bioRxiv - Physiology 2020Quote: ... total RNA was isolated from differentiated 3T3-L1 cells using the RNeasy kit (Qiagen, Hilden, Germany). cDNA was generated using the High-Capacity cDNA Reverse Transcription kit (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by 6 repeats of the TCF/LEF transcriptional response element (AGATCAAAGGGGGTA) joined to a minimal TATA-box promoter and destabilized firefly luciferase reporter (Qiagen, CCS-018L). The cassette for normalization contains a SV40 promoter driving the renilla luciferase open reading frame ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA was extracted from D0 and D7 3T3-L1 cells using an RNeasy Plus Mini Kit (Qiagen #74134). RNA concentration was measured by NanoDrop (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... 3-5 positive colonies per L1 element were chosen for Miniprep culture and plasmid DNA was isolated using QIAprep Spin Miniprep Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Genomic DNA was isolated from 3T3-L1 preadipocytes (day 0) and differentiated adipocytes (day 5) using DNeasy Tissue kit (Qiagen). Two µg of each DNA sample was bisulfite modified using EpiTect Bisulfite kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNAs were isolated from the A549 cells transfected with PD-L1-lnc overexpressed vector or control vector by TRIzol reagent and purified by RNeasy Mini Kit (Qiagen, USA). RNA samples were performed to Microarray analysis by Agilent SurePrint G3 human gene expression Microarray 8X60K (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from 100 mg leaf samples of stressed and unstressed plants [three replicates of each control (WT) and transgenic (L1) plants] using the RNeasy Plant Mini kit (Qiagen, Germany). Sequentially first strand cDNA ...
-
bioRxiv - Genomics 2022Quote: ... At least 3 positive colonies per L1 were chosen for Miniprep culture and plasmid DNA was isolated using a QIAprep Spin Miniprep Kit (Qiagen, Cat#: 27106). At least three clones per element were capillary sequenced and compared to identify PCR-induced mutations ...
-
bioRxiv - Microbiology 2022Quote: ... α-His antibody (Qiagen) was used at 1:5,000 dilution to detect the presence of rRH5 in Native-PAGE.
-
bioRxiv - Microbiology 2020Quote: ... and incubated with primary antibody (Penta·His Antibody, QIAGEN®, 1:2000 dilution) in 1% bovine serum albumin in PBST for 2h at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... and detection was performed using anti-His antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse antibody labeled with AlexaFluor647 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... and detection was performed using anti-His primary antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse secondary antibody labeled with AlexaFluor647 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... and detection was performed using anti-His primary antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse secondary antibody labeled with AlexaFluor647 (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... After incubation with the primary antibody from QIAGEN (Penta-His Antibody, 1:1000 dilution) at RT for 1 h under shaking ...
-
bioRxiv - Genetics 2022Quote: ... using biotinylated His5-antibody (Qiagen), as previously described (Asbury et al. ...
-
bioRxiv - Microbiology 2019Quote: ... and HRP-penta-His antibody (Qiagen) and HRP-anti-mouse IgG (Abcam ...
-
bioRxiv - Biochemistry 2023Quote: ... The PentaHis antibody (Qiagen, Düsseldorf, DE) against His-Tagged proteins was diluted 1:5000 in TBS buffer containing 3% BSA and the membrane was incubated overnight at 4°C followed by 2×10 min washing steps in TBST and 1×10 min in TBS buffers ...
-
bioRxiv - Biophysics 2023Quote: ... anti-Strep-tag antibody (Qiagen, 34850), or anti-HA-tag antibody (Cell Signaling ...
-
bioRxiv - Biochemistry 2020Quote: ... and with a mouse antibody against the His-tag (Tetra·His Antibody, QIAGEN-Cat. No.34670, 1:2,000) in blocking solution on a rocker ...
-
bioRxiv - Biophysics 2021Quote: ... and immunoblotting using anti-Strep antibodies (Qiagen).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... primary mouse anti-His antibody (QIAGEN, 34660), secondary goat anti-rabbit 800CW antibody (LI-COR ...
-
bioRxiv - Microbiology 2022Quote: ... the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Microbiology 2022Quote: ... Tetra·His antibodies (Qiagen, Hilden, Germany; Cat.# 34670), Anti-Mouse IgG (whole molecule) ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Kinetochore proteins were conjugated to these beads using antibodies that recognize specific proteins or their tags: biotinylated anti-His-tag antibodies (6 µg ml−1, Qiagen), biotinylated anti-GFP antibodies (20 µg ml−1 ...
-
bioRxiv - Microbiology 2020Quote: ... a monoclonal mouse Strep-tag antibodies (#34850, Qiagen), a monoclonal anti-actin antibody (A5441 ...
-
bioRxiv - Biochemistry 2022Quote: ... Penta-His Antibody (Qiagen, 34660, IB: 1:1000) and Y188 to APP C-terminus (Abcam ...
-
bioRxiv - Biochemistry 2021Quote: ... analysed by western-blotting using Penta·His Antibody (QIAGEN), of wild-type OxlT measured on the same day of experiment ...
-
bioRxiv - Cell Biology 2019Quote: ... conjugated with anti-penta-his biotin antibody (Qiagen) for 1 and half hours at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies included: anti-Penta-His (QIAGEN, #34650), anti-FLAG M2 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... and HRP–conjugated anti Penta-His antibody (Qiagen). Other chemicals used in this study were of an analytical grade or higher ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies (α-His HRP conjugated (Qiagen 34460) or α -VSV-G (Millipore sigma V4888-200UG) ...
-
bioRxiv - Cell Biology 2023Quote: ... were incubated with biotinylated anti-5His antibodies (Qiagen) and stored for up to 6 months with continuous rotation at 4°C in BRB80 (80 mM Pipes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 40% of the protein material of each fraction was analyzed by Western blot using an anti-his antibody (Penta-His antibody, Qiagen #34660). Detection was performed with a secondary antibody conjugated with horseradish peroxidase (Anti-Mouse IgG Peroxidase antibody ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were fixed at indicated time points after warming and then processed for immuno-identification of HPK using an antibody that recognizes the polyhistidine tag (RGS-His antibody; Qiagen 1:100) and counterstained for nuclei using DAPI ...
-
bioRxiv - Cell Biology 2019Quote: ... the mouse anti-penta-His antibody (Qiagen; Catalog #34660) was used at a 1:2,000 dilution in 3% BSA in PBS with sodium azide ...
-
bioRxiv - Biophysics 2019Quote: ... Biotinylated mouse anti-5xHis antibody was purchase from QIAGEN. Mouse anti Tubulin beta 3 antibody from BioRad (Hercules ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-His is a peroxidase-conjugated antibody (Qiagen). The membranes were incubated for 1 h at room temperature with horseradish peroxidase-conjugated goat anti-rabbit IgG (Sigma ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or mouse anti-RGS-His antibody (Qiagen; cat # 34610) at 1:5000 dilution followed by goat anti-rabbit-HRP conjugate (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse antibodies against the His-tag (1:1000, Qiagen), rabbit antibodies against the C-terminal region of the collagen VI α1 chain (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-penta-His antibody (34660; Lot# 136244018; Qiagen); mouse anti-Myc tag mAb ...
-
bioRxiv - Microbiology 2020Quote: ... The anti-His antibody conjugated to horseradish peroxidase (Qiagen) was used at a dilution of 1:5,000 ...
-
bioRxiv - Plant Biology 2022Quote: ... and NoFa-ICL was the Penta-His antibody (Qiagen) at 1:4000 in TBST ...
-
bioRxiv - Immunology 2022Quote: ... then incubated with the primary antibody anti-His (Qiagen) at a concentration of 1:2500 in a solution of 3% non-fat milk in TBS-T overnight at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Anti-Penta-His antibody was purchased from Qiagen (Germany).
-
bioRxiv - Biophysics 2023Quote: ... The antibodies were anti-RGSHis (Qiagen, Cat. No. 34650) and peroxidase-conjugated anti-mouse antibody (Dako ...