Labshake search
Citations for Qiagen :
1 - 50 of 1352 citations for Exodus 2 CCL21 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: RNA was isolated from snap frozen striatal mouse tissue from 2 independent cohorts of mice according to the manufacturer’s protocol and purified using RNeasy columns (Qiagen). A total of 13 mRNA libraries for Illumina sequencing were prepared using KAPA mRNA HyperPrep Kit (KAPA Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse thyroid tissue was homogenized in buffer RLT using TissueLyser II (Qiagen; 2x 2 min cycles at 30 Hz) and 5 mm stainless steel beads ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mouse thyroid tissue was homogenized in buffer RLT using TissueLyser II (Qiagen; 2x 2 min cycles at 30 Hz) and 5 mm stainless steel beads ...
-
bioRxiv - Immunology 2022Quote: ... the DNA was extracted from 100 mg mouse fecal samples (9-week-old, 2 weeks after final oral gavage treatment) using QIAamp PowerFecal Pro DNA kit (Qiagen) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... including miRNA was isolated from brains of E11 mouse fetuses (3 biological replicates) at 2 h after irradiation using the miRNeasy Mini Kit (Qiagen). RNA was subsequently processed for hybridization to GeneChip miRNA 4.0 microarrays (Affymetrix ...
-
bioRxiv - Immunology 2021Quote: ... 150 ng DNA per reaction was amplified in duplicate using primers and probes specific to γHV68 Orf50 and mouse Ptger2 (see table) and 2× QuantiNova Probe Mastermix (Qiagen). Standard curves were obtained by serial dilutions of Orf50 and Ptger2 gBlocks (ORF50 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Microbiology 2022Quote: ... hACE2 expression or SARS-CoV-2 nucleocapsid (N) gene in individual mouse organs was determined using QuantiNova SYBR Green PCR kit (Qiagen #208052) in combination of 500 nM of hACE2 gene specific primer set (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted and purified from 20 mg (2 pellets) of stool from each mouse using the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germantown, MD). The concentration of DNA in samples was determined by spectrophotometry ...
-
bioRxiv - Biochemistry 2023Quote: Mouse liver RNA was extracted from 10 mg (± 2 mg) of preserved tissue using RNEasy kits and QIAshredders (QIAGEN; Germantown, MD, USA). Aliquots of RNA from each sample were assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... Mouse Obesity (PAMM- 017ZC-12) array and Mouse Aging (PAMM-178ZC) from Qiagen (Maryland, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence of mouse Donson was amplified from XpressRef Universal Total mouse RNA (QIAGEN, 338114) by RT-PCR (Takara ...
-
bioRxiv - Immunology 2019Quote: ... StrEP-Tag (mouse monoclonal, Qiagen, #34850). Peroxidase-conjugated secondary antibodies against rabbit IgG (#7074 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse β-actin (PPM02945B-200, Qiagen), or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-His (Qiagen, number 34660); Mouse anti-β-actin (Proteintech ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Strep (Qiagen, Cat# 34850), and mouse anti-Histidine (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA against mouse VCP (Qiagen, catalog # ...
-
bioRxiv - Biochemistry 2022Quote: ... A mouse monoclonal His-tetra (Qiagen) antibody (1:1000 dilution ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Immunology 2022Quote: ... Mouse and viral DNA were isolated from mouse tissue using the Qiagen DNeasy Blood and Tissue Kit (Qiagen). iTAQ universal Syber Green supermix (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Physiology 2019Quote: ... as well as mouse Tbp (Quantitect, Qiagen) as a housekeeping gene.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... primary mouse anti-His antibody (QIAGEN, 34660), secondary goat anti-rabbit 800CW antibody (LI-COR ...
-
bioRxiv - Microbiology 2022Quote: ... the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse XpressRef Universal Total RNA (QIAgen, 338114) was reverse transcribed and used at a concentration of 250 ng cDNA per reaction as a positive control for each primer set ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Plin2 homology arms were obtained by extracting DNA from mouse primary mouse NSPCs from the SVZ using DNeasy Blood & Tissue Kit (#69506, Qiagen). The sequences covering the sgRNA target site were extracted from the genomic DNA using PCR ...
-
bioRxiv - Genomics 2022Quote: ... The DNA from mouse bladder tumors and matched germline DNA from mouse tails were extracted using the DNeasy Blood Tissue kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...