Labshake search
Citations for Qiagen :
1 - 50 of 1775 citations for DNAM 1 Human HEK 293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: HEK 293 cells were transfected using PolyFect Transfection Reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was prepared from transiently transfected HEK 293 cells using RNeasy Mini Kit (Qiagen) or TRIzol reagent (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... doxycycline-inducible HEK-293 cells was isolated using the RNeasy Mini kit (Qiagen, Germantown, MD, USA). The isolated RNA was processed via reverse-transcription (RT)-PCR and Ψ (percent spliced in ...
-
bioRxiv - Cell Biology 2023Quote: ... stably transduced HEK 293 cells or whole kidneys was extracted using the RNeasy kit (Qiagen, Valencia, CA) with subsequent DNase I treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was extracted from HEK-293 cells or kidney tissues using the QIAamp DNA Mini kit (QIAGEN) and treated with sodium bisulfite using the EZ DNA Methylation kit (Zymo Research ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA was extracted from HEK 293 cells with DNeasy Blood & Tissue Kit (Qiagen, Cat. No. / ID:69504) and PCR amplified with primers specific for the investigated ISL1 region (primers list in supplementary information) ...
-
bioRxiv - Bioengineering 2020Quote: ... The RBD wildtype and mutant proteins of SARS-CoV-2 spike with 10×his tag at N terminal were expressed in HEK 293 and purified with Ni-NTA affinity columns (Qiagen, Hilden, Germany).
-
bioRxiv - Neuroscience 2021Quote: DNAm was analyzed by pyrosequencing on a PyroMark Q24 system (Qiagen, Hilden, GER) using 5 µl biotinylated PCR product of each sample and a previously published sequencing primer (S ...
-
bioRxiv - Genetics 2019Quote: Total RNA from human cell lines (PTC-05, HepG2 and HEK-293T) was extracted using spin columns with the RNeasy Mini Kit (QIAGEN, GmbH, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... and from control and CLN6−/− HEK-293T cells using the RNEasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: RNA from Flp-In™293 cells was extracted using the RNeasy kit (Qiagen) in accordance with the manufacturer’s instructions that included the genomic DNA digestion with DNaseI (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Microbiology 2023Quote: ... All treatment groups were supplemented with 1 % FCS and RNA was extracted in RNAeasy Plus lysis buffer (QIAGEN) 6 h post treatment.
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Immunology 2020Quote: ... The linearized recombinant gDNA was transfected into 293 cells using the PolyFect Transfection Reagent (Qiagen). After virus rescue was observed via plaque formation ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Microbiology 2021Quote: ... Transient transfections of HEK-293T cells were performed using PolyFect transfection reagent per manufacturer instructions (Qiagen). For transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... HEK-293T cells transfected with the desired plasmids by using Attractene Transfection Reagent (301005, QIAGEN, Hilden, Germany), according to the fast-forward protocol ...
-
bioRxiv - Cancer Biology 2022Quote: The DNA was extracted from HEK-293T cells using the DNeasy Blood & Tissue Kit from QIAGEN (#69504). The Samples were prepared and sequenced in Bio Basic Inc ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK 293FT cells were transfected using calcium phosphate method and U2OS cells using Effectene Transfection Reagent (Qiagen). To induce primary cilia ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Cell Biology 2021Quote: ... The genomic DNA (gDNA) of these HEK-293FT cells was isolated using DNeasy Blood & Tissue Kits (Qiagen, no. 69504). The gDNA was further analyzed by qPCR targeting the barcode and the endogenous gene BMP2 using the QuantiNova SYBR Green PCR kit (Qiagen ...
-
bioRxiv - Physiology 2020Quote: ... RNA samples from heart tissue and HEK and CHO cell pellets were purified using a RNeasy mini kit (Qiagen). RNA was reverse-transcribed to cDNA using an Applied Biosystems High-Capacity RNA-to-cDNA kit (Foster City ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK-293T cells were next transfected with pMMP vectors together with retrovirus packaging plasmids using Effectene transfection reagents (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from HEK 293T or CASP1−/− MV4;11 cells at the end of the experiment using the RNeasy Mini Kit (Qiagen) and reverse transcription-PCR was performed on 0.8 µg of mRNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Microbiology 2021Quote: For biotinylated RIPs HEK-293T cells were seeded and transfected with 20nM biotinylated LNA miR-29b or miR-30c (Qiagen) in combination with 2 μl Lipofectamine RNAi Max (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...
-
bioRxiv - Developmental Biology 2020Quote: ... mUHRF1 C-terminally tagged with GFP- and 6xHis-tag was expressed in HEK 293T cells and then purified using Qiagen Ni-NTA beads (Qiagen #30230). Recombinant mDPPA3 WT and 1-60 were purified as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK-beta cells were transiently transfected with WT or variant NaV1.2 (2 µg) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.).
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from INS-1 and human islets 48 hours post transfection using RNeasy cleanup kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... This construct was co-transfected with the pVSV-G retroviral coat protein expression vector into GP2-293 packaging cells using Effectene (Qiagen Sciences, Inc.; Germantown, MD). At 24 h and again at 48 h post-transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Immunology 2023Quote: ... supernatants were harvested and His-tagged tIgM-Fc (tFcµ) protein was purified using Ni-NTA Agarose (Qiagen) and subsequently ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...