Labshake search
Citations for Qiagen :
1 - 50 of 1864 citations for C Type Lectin Domain Family 2 Member B CLEC2B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: DNA was extracted from all family members from whole blood using Puregene chemistry (Qiagen). Exome capture was undertaken in both affected individuals using the SureSelect 50 Mb All Exon Kit v3 (Agilent ...
-
bioRxiv - Cell Biology 2019Quote: ... GGA family member and interactor targeting siRNAs (Oligo IDs indicated in Fig. S1A) and control siRNA were purchased from Qiagen. Before plating MDA-MB-231 cells on CSMA ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA was isolated from various tissue samples collected from patients and their family members with a Gentra DNA extraction kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Genomic DNA for Family 1100 and Family 2100 was extracted with the MagAttract HMW DNA Kit (Qiagen) from whole blood samples of individuals enrolled in a human subjects research protocol approved by the New York University Grossman School of Medicine Institutional Review Board.
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR for individual miR-17∼92 members was performed using miRCURY LNA probes and miRCURY LNA SYBR Green PCR Kit (Qiagen).
-
bioRxiv - Biophysics 2020Quote: Genomic DNA from Pitohui uropygialis meridionalis (Family Oriolidae) blood and tissue was extracted using DNeasy kits (Qiagen) to create whole genome sequence libraries for the poisonous Pitohui birds ...
-
bioRxiv - Developmental Biology 2022Quote: ... Gene expression of different fos family genes in zebrafish was analyzed using Quantitect™ Primer Assays (Qiagen) for each individual gene – fosaa ...
-
bioRxiv - Genomics 2019Quote: Total RNA was extracted from leaf tissues collected from homozygous resistant and susceptible families and the two parents using the RNeasy Plant Mini Kit (QIAGEN) according to the manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: Inhibitors (antimiRs) against miR26b-5p and miR200a/b/c-3p were purchased from Qiagen (339130 and 339160 respectively). AntimiRs in injection media (1mM Tris-HCL pH 7.5 and 0.5 mM EDTA in embryo grade water ...
-
bioRxiv - Immunology 2021Quote: The indicated cell types were harvested and stored at −80°C until RNA was isolated using RNeasy kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Each reaction of the HRM assay included 6.25µl of Type-IT 2 x HRM buffer (QIAGEN, Germany), primers specific for the uidA E.coli housekeeping gene and molecular grade water was added to make a final volume of 12.5µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Cell Biology 2023Quote: ... B) Proteinase K (Qiagen) diluted with PBS to 20 μg·ml-1 final concentration ...
-
bioRxiv - Molecular Biology 2020Quote: RNA was extracted from 14-day-old wild-type and acinus-2 pinin-1 seedlings using RNeasy mini kit (Qiagen) and treated with TURBO DNA-free Kit (Ambion ...
-
bioRxiv - Developmental Biology 2019Quote: ... total RNAs were extracted from wild-type and Cables2-deficient EpiLCs at 2 days post-induction (n = 3) using RNeasy Plus Mini Kit (Qiagen). RNA quality was evaluated using Agilent Bioanalyzer with RNA 6000 Pico kit (Agilent Technologies Japan ...
-
bioRxiv - Plant Biology 2023Quote: Two-week-old Arabidopsis seedlings of Col-0 wild type and trb1/2/3 triple mutans were used for DNA extraction using DNeasy Plant Mini Kit (QIAGEN). A total of 500 ng DNA was sheared with Covaris S2 (Covaris ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA and proteins were extracted from fresh or snap-frozen FACS-sorted 2-5 million splenic B cells using AllPrep DNA/RNA/Protein Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... or remaining mosquito bodies were collected separately in a 2ml Eppendorf Safe Lock tube with 250μl DMEM (2% FBS, 1% Sodium Pyruvate) with 25 mg/ml Amphotericin B and a stainless steel bead (Qiagen, Hilden, Germany). Samples were stored at −80°C.
-
bioRxiv - Molecular Biology 2021Quote: ... or Puregene Core Kit B (Qiagen). Homozygously edited cells were identified using PCR and Sanger sequencing of gel extracted fragments (gel extraction performed using QIAquick Gel Extraction Kit from Qiagen ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (20 mg of proteins/ml of resin ...
-
bioRxiv - Genetics 2021Quote: ... 0.4 μl H2O (Type-it Kit, QIAGEN) and 75 μg of template DNA ...
-
bioRxiv - Genetics 2021Quote: ... 0.2 μl Q (Type-it Kit, QIAGEN), 0.4 μl H2O (Type-it Kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... EvaGreen (Type-it HRM PCR Kit, Qiagen) and the manufacturers recommended protocol for use ...
-
bioRxiv - Molecular Biology 2023Quote: ... EvaGreen (Type-it HRM PCR Kit, Qiagen) and the manufacturers recommended protocol for use ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 μl Type-it Master Mix (Qiagen), 0.17 μM of either FAM or VIC ...
-
bioRxiv - Biophysics 2021Quote: ... The correct band with the GRB2-SH3 domain was purified using the MinElute Gel Extraction Kit (QIAGEN) and the sample was quantified using a Qubit fluorometer to be cloned into the yeast assay plasmids by high efficiency temperature-cycle ligation64.
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Genetics 2019Quote: ... 1× Type-it Multiplex PCR Master Mix (Qiagen), 0.2 μM of each locus specific reverse primers ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated for ~2 h rotating at 4°C with Ni-NTA Resin (Qiagen, 1018244) that had been washed with wash buffer (20mM Tris HCl pH 8.0 ...
-
bioRxiv - Genomics 2022Quote: ... Samples were incubated overnight at 55°C before adding 2 µl of RNaseA (100 mg/ml, Qiagen) and incubated for 15 min at 45°C ...
-
bioRxiv - Immunology 2020Quote: RNA from isolated fresh B cells and B cells activated with LPS/IL-4 was extracted using a RNeasy kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... or (B) a QIAquick PCR purification column (Qiagen) (proK-col) ...
-
bioRxiv - Biochemistry 2021Quote: The DNA sequence encoding each ankyrin repeat domain was chemically synthesized and cloned into pQIq expression vectors (Qiagen, Germany) by Gibson Assembly 38.
-
bioRxiv - Biochemistry 2023Quote: ... Soluble lysate was prepared by centrifugation and the kinase domain of FGFR1 was isolated by Ni-NTA column (Qiagen).
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Immunology 2024Quote: ... 2 × 104 cells were sorted in triplicate per sample and stored at −80°C in RLT buffer (Qiagen). RNA was isolated using the Qiagen RNeasy Micro Kit ...
-
bioRxiv - Cell Biology 2020Quote: The validated Alx1DN (N-terminal portion of protein product containing homeodomain and nuclear localization domains) clones in pCS2+8 were purified via miniprep (Qiagen) alongside a control (C-terminal portion containing transactivation domain) ...
-
bioRxiv - Genomics 2020Quote: ... and GeneRead Adapter I set B (Qiagen, cat # 180986) according to Qiagen protocol with one exception ...
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: ... and Negative control B Antisense LNA GapmeR (Qiagen, LG00000001) were used as controls for siRNAs and ASOs ...
-
bioRxiv - Immunology 2023Quote: ... 40mM Tris-HCl ph 6.5 for 2 hour at 45°C prior to purification with QIAquick PCR Purification Kit (Qiagen). For ‘input’ DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1h at 37 °C (2 units per sample) followed by purification with the RNeasy miniElute Cleanup kit (Qiagen).
-
bioRxiv - Biophysics 2021Quote: ... 2 g/ml Biotinylated Anti-His Antibody (Penta-His Biotin Conjugate; Qiagen; No. 34440) in T50 buffer was introduced into flow cells at 50 μl/min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used the Type-It Multiplex PCR Master Mix (Qiagen) 1x ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1X Master Mix of Type-it Microsatellite PCR Kit (Qiagen), 4 μL Q-Solution ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The final domain-insertion library was obtained by purifying plasmids from this cell slurry using a QIAprep Spin Miniprep Kit (Qiagen, Inc.).
-
bioRxiv - Cell Biology 2020Quote: ... RNA was further digested with TURBO DNase overnight at 37°C (10 U per 2 μg of RNA) and purified with the RNeasy MinElute Cleanup Kit (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...