Labshake search
Citations for Qiagen :
1 - 50 of 3130 citations for 8 Chloro 4 methyl 1 2 dihydroquinolin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
bioRxiv - Biochemistry 2022Quote: IQN17 was crystallized at room temperature in a hanging-drop vapor diffusion system by mixing 0.3 μL of 15 mg/mL peptide with 0.3 μL of reservoir solution containing 0.1 M imidazole (pH 8.0) and 35 % 2-methyl-2,4-pentanediol (MPD) (Qiagen). Crystals were seen two days after trays were set up ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... (NM-2) one negative control for the kit DNeasy Blood and Tissue (Qiagen) used for DNA extraction of minipig blood and (NM-3 ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was detected using One-step probe RT-qPCR kits (Qiagen) run on the CFX96 detection system (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was detected using One-step probe RT-qPCR kits (Qiagen) run on the CFX96 detection system (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Immunology 2021Quote: ... Twenty consecutive 10 μm sections were placed on glass slides for subsequent IHC (sections 1-2, 7-8, 13-14, & 19-20) or placed in 600 μl buffer RLT (Qiagen) containing 1% 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Microbiology 2024Quote: ... run using the QIAcuity One Digital PCR System (Qiagen, 2-plex Device, Cat. No. 911001). The following conditions were used for the one-step cycling dPCR program ...
-
bioRxiv - Genomics 2022Quote: ... Trachea was dissected and immersed in 1 mL PBS in a 2 mL microcentrifuge tube (Fisherbrand, 14-666-315) containing one stainless steel bead (QIAGEN, 69989). After the homogenization ...
-
bioRxiv - Genomics 2023Quote: ... Cell-free RNA was isolated from between 2-8 mL following manufacturer’s instructions (Qiagen, 55114). Isolated RNA was DNase-treated (Lucigen ...
-
bioRxiv - Genetics 2019Quote: ... for lysis in 2 ml safe-lock tubes containing one 5 mm stainless steel bead (Qiagen) for 2.5-3 minutes at 30 Hz using TissueLyzer II (Qiagen) ...
-
bioRxiv - Neuroscience 2022Quote: ... CD11b+ CD45+ cells from one animal (2 retinas) were sorted directly into RLT buffer (QIAGEN 79216) and stored at -80°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Genomics 2020Quote: ... cells were mixed 1:2 with RNAProtect (Qiagen) and harvested via centrifugation ...
-
bioRxiv - Microbiology 2019Quote: ... from the ME phase and ES phase (1 ml) were added to 4 ml and 2 ml of RNAprotect Bacteria Reagent (Qiagen), respectively ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mL of fermentor culture was added to 4 mL RNAprotect Bacteria Reagent (Qiagen) and immediately vortexed for 10 sec ...
-
bioRxiv - Microbiology 2024Quote: ... resuspended in 2 mL salts mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen), and then incubated for 5 min at room temperature for stabilization before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from OSU-CLL cells (1.5e6 cells/mL) treated with DMSO or SpiD3 (1, 2 μM; 4 h) using the miRNeasy Mini Kit (Qiagen; Hilden, Germany) per manufacturer instructions and processed using the Universal Plus mRNA-Seq with NuQuant kit (Tecan ...
-
bioRxiv - Microbiology 2022Quote: ... One volume of bacterial culture containing approximately 0.2 OD600 of cells was mixed with 2 volumes of RNAprotect (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... One half of clarified cell lysate (2 ml) was applied to 200 μl of Ni-NTA Superflow resin (Qiagen) equilibrated with Ni wash buffer (20 mM HEPES pH 8.0 ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease73 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Genetics 2023Quote: ... Further confirmation of which allele was deleted in clones with only one UBE3A copy was performed by utilizing the EpiTect Methyl II DNA Restriction Kit (QIAGEN, #335452) to measure methylation at the PWS-IC (SNRPN ...
-
bioRxiv - Microbiology 2023Quote: ... The pure genomic DNA was sheared by ultrasound and 2-8 kb fragments were extracted from a 0.7% agarose gel using the Gel Extraction Kit (Qiagen). The gel-recovered fragments were ligated to the linearized PZE12 vector (prime 3,4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of bisDNA was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 2 μl of 10 μM primer mix (Methods Table 1) ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (20 mg of proteins/ml of resin ...
-
bioRxiv - Immunology 2021Quote: ... Skin samples were homogenized in a TissueLyser LT (Qiagen, 50 Hz, 2 times 4 minutes) using 5 mm stainless steel beads (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 10 µl of the cell suspension from each dilution was dispensed into 24 wells of a 96 well plate containing 2 μl One-step RT-PCR enzyme (Qiagen), 10 μl 5x One-step RT-PCR buffer (Qiagen) ...
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Cell Biology 2022Quote: ... with 1% 2-mercaptoethanol then passed through Qiashredder tubes (Qiagen). RNA was extracted using the RNeasy Isolation Kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... loaded with 1-2 ml Ni-NTA agarose resin (Qiagen) pre-equilibrated with binding buffer ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Genetics 2019Quote: ... in each well of 8-stripped PCR tubes by shaking with a zirconia bead (2 mm in diameter, Nikkato, Japan) in TissuLyser II (Qiagen) for 30 s at 30 Hz ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 mL cultures were immediately added to centrifuge tubes containing 4 mL RNAprotect Bacteria Reagent (Qiagen), vortexed for 5 seconds and incubated at room temperature for 5 min ...
-
bioRxiv - Genomics 2021Quote: cfDNA was extracted from 2-4 mL of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.
-
bioRxiv - Cancer Biology 2019Quote: ... Germany) using a metal ball for 2×2 min at 25 s−1 in 600 μl of RLT buffer (Qiagen, Germany) with 1% β-mercaptoethanol ...
-
bioRxiv - Microbiology 2021Quote: A total of 2 x 105 Vero E6 or HEK293ACE-2 cells were seeded 24 hours before transfection with one of the following siRNAs pools (Qiagen SMARTpool): siSTT3A (#GS3703) ...