Labshake search
Citations for Qiagen :
1 - 50 of 1055 citations for 7 propan 2 ylidenebicyclo 2.2.1 hept 2 ene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... and collected into a PCR tube containing 7 µL of 2×TCL lysis buffer (Qiagen) with 2% v/v 2-mercaptoethanol (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... were transfected with 10 nM Malat1 ENE-targeting (ASO) or control (Con) steric blocking ASOs (Exiqon, Qiagen) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... Twenty consecutive 10 μm sections were placed on glass slides for subsequent IHC (sections 1-2, 7-8, 13-14, & 19-20) or placed in 600 μl buffer RLT (Qiagen) containing 1% 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: RNA was extracted from root tips (1-2 mm) of 7-d-old seedlings using the RNEasy plant mini kit (QIAGEN), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: Total mRNA was isolated from 2 dpf or 7 dpf zebrafish homogenates using the RNeasy Mini Kit (Qiagen, Cat# 74104) and reverse-transcribed with SuperScript VILO (ThermoFisher ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Microbiology 2022Quote: ... Organs were homogenized by high-speed shaking in 2 mL microcentrifuge tubes filled with sterile PBS and 5/7 mm stainless steel beads using TissueLyser LT (Qiagen, Hilden, Germany).
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated from cultures infected with rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 using the QIAamp Viral RNA mini kit (Qiagen) and cDNA synthesis was performed using SuperScript III using hexamers (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Physiology 2023Quote: ... the RNAs from livers (n = 2 mice/group, each group contains RNAs pooled from 2 mice) were prepared (RNeasy, Qiagen). Ribosomal RNA was removed with the Ribozero HMR Gold kit (Illumina).