Labshake search
Citations for Qiagen :
1 - 50 of 3783 citations for 7 hydroxy 1H 1 2 4 triazolo 1 5 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 5× One-step RT-PCR buffer (QIAGEN), 10 μL Triton-x100 (0.3% ...
-
bioRxiv - Genomics 2022Quote: ... The reactions were incubated for 15 min at 60 °C and then terminated by adding 1 μl 5 M NaOH to degrade RNA and heating at 95 °C for 5 min followed by neutralization with 1 μl 5 M HCl and one round of MinElute column clean-up (Qiagen). The R1R DNA adapter was adenylated by using a 5’ DNA Adenylation kit (New England Biolabs ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Genetics 2019Quote: ... for lysis in 2 ml safe-lock tubes containing one 5 mm stainless steel bead (Qiagen) for 2.5-3 minutes at 30 Hz using TissueLyzer II (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µM of forward and reverse oligos were heated for one minute at 100°C with 5 mM MgCl2 and 7 mM Tris-Cl (i.e. Qiagen Elution Buffer) and annealed by slowly cooling to room temperature.
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Immunology 2023Quote: ... 14-666-315) containing 1 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Nucleic acids were isolated from excised granulomas by homogenizing in TRIzol (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Bioengineering 2023Quote: ... on a 5-plex QIAcuity One digital PCR instrument (Qiagen, 911021). The thermal cycling conditions were implemented using the following program ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Genomics 2020Quote: ... 5 µL Proteinase-K (20 mg ml-1, Qiagen) was added to the solution and incubated at 60°C for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... then 24 mL buffer PB (5:1, Qiagen #19066) and 1.2mL NaOAc were added sequentially ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Genetics 2020Quote: ... 30 mg of snap frozen tissues were processed adding 1 ml of QIAzol reagent in presence of one 5 mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCGTCATCAGGATTGGCAA and probe 5’-TGGGTGTCTGCTTTGGAACA were used in a one-step qRT-PCR reaction with either Quantifast reagents (Qiagen) for tissue RNA or LightCycler 480 RNA Master Hydrolysis Probes (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... one 5 mm bead per sample was used in a TissueLyser (Qiagen) for 4 min at 30 Hz ...
-
bioRxiv - Bioengineering 2023Quote: ... on a 5-plex QIAcuity One digital PCR instrument (911021, Qiagen, USA). The thermal cycling conditions were implemented using the following program ...
-
bioRxiv - Genomics 2020Quote: ... purified nucleic acids were treated with 1-5 μl 1 mg/ml RNaseA (Qiagen) for 45 minutes at 37 °C to degrade RNA ...
-
bioRxiv - Physiology 2023Quote: ... Ganglia in 1 mL of TRIzol reagent were homogenized using a TissueLyzer II bead mill (one 5 mm stainless steel bead per tube, 30 s-1 frequency for 3 minutes; Qiagen Inc. Hilden, Germany). The homogenates were incubated with 200 µL chloroform and centrifuged for 15 minutes at 12000 x g to isolate the protein-containing organic phase ...
-
bioRxiv - Genomics 2022Quote: The second lobe of lung or trachea was immersed in 1 mL PBS in a 2 mL Micro Centrifuge Tube (Fisherbrand, 14-666-315) containing one stainless steel bead (5 mm, QIAGEN, 1026563) immediately after dissecting the SARS-CoV-2 infected mouse or hamster ...
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Organs were homogenized by high-speed shaking in 2 mL microcentrifuge tubes filled with sterile PBS and 5/7 mm stainless steel beads using TissueLyser LT (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Microbiology 2023Quote: ... containing 500 µl PBS and one 5 mm steel bead (Qiagen, Hilden, Germany) prior to bead-beating for 20 seconds to disrupt the cuticle ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Immunology 2019Quote: ... longitudinal muscle/myenteric plexus preparations were homogenized in a 2 ml eppendorf containing 1 ml Trizol and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... Cells were rinsed at rested at 37°C for a minimum of 1h before undergoing red-blood-cell lysis by 5-10 ml RBC lysis solution (Qiagen) for 20 min at room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Immunology 2022Quote: ... The middle and inferior right lobes were weighted and homogenized with PBS (1:5 w/v) using a 5 mm stainless steel bead (Qiagen, USA) and a TissueLyser LT (Qiagen ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from approximately 100 EBs (differentiation day 2 and 3) or 25 EBs (differentiation day 4 and 5) using RNeasy Mini kit (Qiagen). 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4-5 hours later DNA was transfected using Attractene (Qiagen). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... Medium was stirred for 1 hour at 4°C in the presence of 5 ml Ni-NTA Agarose beads (Qiagen, Venlo, The Netherlands) washed with 25 mM Hepes-KOH pH 7.5 ...
-
bioRxiv - Microbiology 2024Quote: ... One µg of purified RNA was treated twice with 5 µl of RNAse-free DNAse (Qiagen) and subjected to a final on column purification ...
-
bioRxiv - Microbiology 2019Quote: ... Cell lysates were then incubated at 4 °C for 1-1.5 hours on one ml of Ni-NTA resin (Qiagen). The resin was then loaded into columns (Biorad ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Molecular Biology 2023Quote: Approximately 5 mg of frozen liver was homogenized in 1 ml RLT buffer (Qiagen) using a BeadBeater (BioSpec ...