Labshake search
Citations for Qiagen :
1 - 50 of 3605 citations for 7 CHLORO 2H PYRIDO 2 3 B 1 4 OXAZIN 3 4H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Biochemistry 2019Quote: ... 3-4 mL of Ni-NTA superflow resin (Qiagen) were loaded onto a column and equilibrated with the resuspension buffer ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
bioRxiv - Bioengineering 2019Quote: ... Cells were harvested after 3 or 7 days post-transfection (RNEasy mini kit, Qiagen), whereby cDNA was made and amplified via qPCR with primers for GAPDH ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or a 3:2 mixture of QG buffer (QIAGEN) and isopropanol ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Immunology 2019Quote: ... Human RAC2 3’UTR was amplified with One Step Ahead RT-PCR kit (Qiagen) from human mRNA using the following primers RAC2 3’UTR+ ...
-
bioRxiv - Neuroscience 2022Quote: Tissue cultures that were cultivated on one filter membrane (3 cultures) were transferred as one sample into RLT buffer (QIAGEN) and RNA was isolated according to the manufacturer’s instructions (RNeasy Plus Micro Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from approximately 100 EBs (differentiation day 2 and 3) or 25 EBs (differentiation day 4 and 5) using RNeasy Mini kit (Qiagen). 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... Clarified lysate was mixed with Ni-NTA agarose at 4℃ for 2h (Qiagen). Bound protein was eluted in 20 mM Tris pH 8.0 ...
-
bioRxiv - Physiology 2023Quote: ... Ganglia in 1 mL of TRIzol reagent were homogenized using a TissueLyzer II bead mill (one 5 mm stainless steel bead per tube, 30 s-1 frequency for 3 minutes; Qiagen Inc. Hilden, Germany). The homogenates were incubated with 200 µL chloroform and centrifuged for 15 minutes at 12000 x g to isolate the protein-containing organic phase ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Genomics 2024Quote: ... the Qiagen RNeasy Mini Kit was used according to Qiagen RNA Protect Reagent Handbook Protocols 4 and 7 with Appendix B on-column DNase digestion (Qiagen, Hilden, Germany). The RNA was assessed with UV-Vis spectrophotometry (Denovix DS-11 ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Microbiology 2024Quote: ... used for DNA extraction of minipig blood and (NM-3) one negative control for the kit DNeasy PowerWater (Qiagen) used for the DNA extraction of water samples ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Cell Biology 2019Quote: ... KIF4A siRNA 5’-CAGGTCCAGACTACTACTC-3’ against the 3’-UTR was obtained from QIAgen, and an optimised siRNA pool for KIF22 (KID ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...