Labshake search
Citations for Qiagen :
1 - 50 of 1533 citations for 6H THIENO 2 3 B THIOPYRAN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and 6h time points using the RNeasy Plus kit (QIAGEN). The RNAs were used as a template for cDNA synthesis followed by qRT-PCR to quantify mRNA level ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from RAW264.7 cells cultured for 6h using RNeasy kits according to manufacturer’s protocols (Qiagen, Denmark). After 24h culture ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or a 3:2 mixture of QG buffer (QIAGEN) and isopropanol ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... NHEJ reporter plasmid was digested with I-Sce1 for 6h and purified using a QIAEX II Gel Extraction Kit (QIAGEN). Exponentially growing cells were transfected using an Amaxa nucleofector with the U-023 program ...
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Immunology 2021Quote: ... total RNA was isolated from 0.4×106 FACS-sorted B220hi CD138- and B220low CD138+ B cells (derived from 3 biological replicates after eight days in culture) using the RNeasy Mini Kit (Qiagen). cDNA was generated from polyadenylated transcripts employing the SMART-Seq v4 ultra low input RNA kit (Takara Bio) ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Cell Biology 2023Quote: ... B) Proteinase K (Qiagen) diluted with PBS to 20 μg·ml-1 final concentration ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA and proteins were extracted from fresh or snap-frozen FACS-sorted 2-5 million splenic B cells using AllPrep DNA/RNA/Protein Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... or remaining mosquito bodies were collected separately in a 2ml Eppendorf Safe Lock tube with 250μl DMEM (2% FBS, 1% Sodium Pyruvate) with 25 mg/ml Amphotericin B and a stainless steel bead (Qiagen, Hilden, Germany). Samples were stored at −80°C.
-
bioRxiv - Molecular Biology 2021Quote: ... or Puregene Core Kit B (Qiagen). Homozygously edited cells were identified using PCR and Sanger sequencing of gel extracted fragments (gel extraction performed using QIAquick Gel Extraction Kit from Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: Total DNA was isolated from 2-3 weeks old seedlings with DNeasy Plant Mini Kit (QIAGEN). 1ng of DNA per qPCR reaction was used as template ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Immunology 2020Quote: RNA from isolated fresh B cells and B cells activated with LPS/IL-4 was extracted using a RNeasy kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... or (B) a QIAquick PCR purification column (Qiagen) (proK-col) ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Microbiology 2020Quote: ... Cells were mechanically disrupted by bead-beating for 2 × 3 min at 30 Hz (TissueLyser II, Qiagen, Hilden, Germany). The samples were incubated at −80°C for 10 min and at 95°C for 10 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... using the QIAGEN TissueLyser at 15 Hz for 2-3 min with a Stainless-Steel Bead (QIAGEN catalog # 69989). Phase separation was induced with chloroform ...
-
bioRxiv - Genomics 2020Quote: ... and GeneRead Adapter I set B (Qiagen, cat # 180986) according to Qiagen protocol with one exception ...
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: ... and Negative control B Antisense LNA GapmeR (Qiagen, LG00000001) were used as controls for siRNAs and ASOs ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA was extracted from fresh leaves of 2 to 3-week-old seedlings for all lines using a Qiagen MiniPrep Kit (Qiagen). Genotyping of all lines was performed using a custom lentil exome capture assay as described in Ogutcen et al ...
-
bioRxiv - Neuroscience 2020Quote: ... including miRNA was isolated from brains of E11 mouse fetuses (3 biological replicates) at 2 h after irradiation using the miRNeasy Mini Kit (Qiagen). RNA was subsequently processed for hybridization to GeneChip miRNA 4.0 microarrays (Affymetrix ...
-
bioRxiv - Neuroscience 2021Quote: ... (n=3 biological replicates) and TACs (hGFAP::GFP-, CD133-, EGFR+, CD24-) (n=2 biological replicates) using the miRNeasy kit (Qiagen). miRNAs were pre-amplified and profiled using TaqMan® Array Rodent MicroRNA A Cards v2.0 A as specified by the manufacturer at the Genome Technology Center of New York University Langone Medical Center ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was isolated from 3D samples (n=2-3) by combining a TRIzol-based cell lysis with a RNeasy Mini Kit (Qiagen). Samples were collected at aforementioned timepoints ...
-
bioRxiv - Developmental Biology 2019Quote: ... total RNAs were extracted from wild-type and Cables2-deficient EpiLCs at 2 days post-induction (n = 3) using RNeasy Plus Mini Kit (Qiagen). RNA quality was evaluated using Agilent Bioanalyzer with RNA 6000 Pico kit (Agilent Technologies Japan ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from approximately 100 EBs (differentiation day 2 and 3) or 25 EBs (differentiation day 4 and 5) using RNeasy Mini kit (Qiagen). 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Plant Biology 2023Quote: Two-week-old Arabidopsis seedlings of Col-0 wild type and trb1/2/3 triple mutans were used for DNA extraction using DNeasy Plant Mini Kit (QIAGEN). A total of 500 ng DNA was sheared with Covaris S2 (Covaris ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...