Labshake search
Citations for Qiagen :
1 - 50 of 3275 citations for 6 Oxabicyclo 3.1.0 hexan 2 ol 5 methyl 2 1Z 1 propenyl 1R 2S 5S rel 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and 5S rRNA (Qiagen, CA). All reactions were performed in triplicate ...
-
bioRxiv - Neuroscience 2019Quote: Controls: 5S rRNA (Qiagen, cat. #YP00203906) and UniSp6 (Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μl of diluted (0.08x) QIAseq FastSelect 5S/16S/23S (Qiagen) were added into 6 μl COVID-19 specimen RNA along with 3 μl NA denaturation buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Biochemistry 2022Quote: IQN17 was crystallized at room temperature in a hanging-drop vapor diffusion system by mixing 0.3 μL of 15 mg/mL peptide with 0.3 μL of reservoir solution containing 0.1 M imidazole (pH 8.0) and 35 % 2-methyl-2,4-pentanediol (MPD) (Qiagen). Crystals were seen two days after trays were set up ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Microbiology 2022Quote: ... depletion was performed during library preparation using three probes from QIAGEN FastSelect rRNA 5S/16S/23S Kit (Qiagen, Hilden, Germany), respectively ...
-
bioRxiv - Systems Biology 2023Quote: ... using the QIAseq FastSelect -5S/16S/23S kit (Qiagen). The transcriptomic reads were mapped to the combined sequence of the host genome and expression plasmid sequence by following the Modulome workflow (https://github.com/avsastry/modulome-workflow ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Immunology 2019Quote: ... approximately 25 mg of tissues were homogenized in 2 mL tubes containing 600 μL of Buffer RLT with 2% β-mercaptoethanol and a stainless steel bead (5 mm, Qiagen) using a TissueLyser II system (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: 2 × 105 cells were reverse-transfected in 6-well plates with Flexitube siRNA constructs (Qiagen) targeting KEAP1 (KEAP1_5 or KEAP1_8) ...
-
RNA-seq sample preparation kits strongly affect transcriptome profiles of a gas-fermenting bacteriumbioRxiv - Systems Biology 2022Quote: ... “Qiagen” with QIAseq® FastSelect™ –5S/16S/23S Kit (335925; Qiagen) (for rRNA removal ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cq values were normalized to the endogenous control 5S rRNA (YP00203906, Qiagen). Relative miRNA expression was determined using the 2 −ΔΔCt method (67).
-
bioRxiv - Microbiology 2022Quote: ... rRNA was depleted using the QIAseq FastSelect−5S/16S/23S Kit (Qiagen) and cDNA libraries were prepared with KAPA RNA Hyaperprep kit KR1350 – v2.17 (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... and rRNA was removed using QIAseq FastSelect-5S/16S/23S kit (Qiagen). DNA and RNA from fecal samples were extracted using the ZymoBIOMICS DNA/RNA miniprep kit (Zymo) ...
-
bioRxiv - Microbiology 2023Quote: ... rRNA was first depleted using the QIAseq FastSelect -5S/16S/23S (Qiagen) kit per the protocol with some modifications ...
-
bioRxiv - Microbiology 2024Quote: ... Ribosomal RNA was removed using QIAseq FastSelect –5S/16S/23S kit (Qiagen). Sequencing libraries were prepared with the KAPA Stranded RNA-Seq Library Preparation Kit (Kapa Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... ribosomal RNAs were removed with a 5S/16S/23S Fastselect kit (Qiagen). These libraries were prepared with the Kapa Hyper Stranded mRNA library kit (Roche) ...
-
bioRxiv - Cell Biology 2024Quote: The kit QIAseq FastSelect –5S/16S/23S (Cat# 335921, Qiagen, Hilden, Germany) was used for inhibiting the amplification of ribosomal RNA during library preparation which was then performed from 120ng total RNA of E ...
-
bioRxiv - Genomics 2020Quote: ... cells were mixed 1:2 with RNAProtect (Qiagen) and harvested via centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... rRNA removal was performed using the QIAseq FastSelect- 5S/16S/23S kit (Qiagen). MetaRibo-Seq libraries were prepared using the NEBNext Small RNA Library Prep set for Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... As outlined by the QIAseq FastSelect 5S/16S/23S rRNA handbook from Qiagen, 1.5 µL of 12 µL FastSelect FH Buffer ...
-
bioRxiv - Pathology 2022Quote: ... with stainless steel beads (2×5 mm) using a TissueLyser (Qiagen, Germantown, MD) for three minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... with 2 × 5 mm stainless steel beads using the TissueLyser (Qiagen, Hilden, Germany) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 2–5 min with steel balls in a tissue lyser (Qiagen, Germany). Tissue lysates were incubated with the buffer at 4°C overnight (cell samples were incubated in lysis buffer for 30 min at 4°C) ...
-
bioRxiv - Immunology 2019Quote: ... longitudinal muscle/myenteric plexus preparations were homogenized in a 2 ml eppendorf containing 1 ml Trizol and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Molecular Biology 2024Quote: ... rRNA depletion was performed using the QIAseq FastSelect 5S/16S/23S kit (Qiagen, UK) in accordance with manufacturer’s instructions with the addition of RNase inhibitor (New England BioLabs ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNAs were isolated from 6-month H19ΔICR/H19ΔICR and H19+/H19+ littermates (2 per genotype) using RNeasy Plus Mini Kit (Qiagen). Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina) ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Cell Biology 2022Quote: ... with 1% 2-mercaptoethanol then passed through Qiashredder tubes (Qiagen). RNA was extracted using the RNeasy Isolation Kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... loaded with 1-2 ml Ni-NTA agarose resin (Qiagen) pre-equilibrated with binding buffer ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Systems Biology 2022Quote: ... ribosomal RNA (rRNA) was removed using the QIAseq FastSelect −5S/16S/23S Kit (335925; Qiagen) and stranded mRNA libraries were prepared using the QIAseq Stranded RNA Lib Kit (180743 ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA was depleted using the QIAseq FastSelect 5S/16S/23S kit for bacteria (Qiagen), according to manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2024Quote: ... ribosomal RNA (rRNA) was removed using the QIAseq FastSelect –5S/16S/23S Kit (335925; Qiagen) and stranded mRNA libraries were prepared using the QIAseq Stranded RNA Lib Kit (180743 ...
-
bioRxiv - Evolutionary Biology 2023Quote: Depletion of rRNA from extracted RNA was performed using QIAseq FastSelect −5S/16S/23S (Qiagen). Samples were incubated at 89°C for 8 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: Total RNAs were extracted from the FACS-isolated EGFP+ OLs with RNeasy Micro kit (Qiagen). For total RNA extraction from the other hemisphere forebrain (without OL sorting) ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).