Labshake search
Citations for Qiagen :
1 - 50 of 2495 citations for 6 Cyclopentadecen 1 one 3 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Genetics 2023Quote: ... Further confirmation of which allele was deleted in clones with only one UBE3A copy was performed by utilizing the EpiTect Methyl II DNA Restriction Kit (QIAGEN, #335452) to measure methylation at the PWS-IC (SNRPN ...
-
bioRxiv - Microbiology 2023Quote: ... The SCGs cultured in 6-well dishes and one entire 6-well was harvested and pooled together for RNA isolation (RNeasy, Qiagen) per sample ...
-
bioRxiv - Neuroscience 2022Quote: Tissue cultures that were cultivated on one filter membrane (3 cultures) were transferred as one sample into RLT buffer (QIAGEN) and RNA was isolated according to the manufacturer’s instructions (RNeasy Plus Micro Kit ...
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Immunology 2019Quote: ... Human RAC2 3’UTR was amplified with One Step Ahead RT-PCR kit (Qiagen) from human mRNA using the following primers RAC2 3’UTR+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... Epitect Methyl II PCR Array System (Qiagen) was used to determine the CpG island methylation status of CDH1 (E-Cadherin) ...
-
bioRxiv - Neuroscience 2022Quote: EpiTect Methyl II PCR Primer Assay (Qiagen) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Physiology 2023Quote: ... Ganglia in 1 mL of TRIzol reagent were homogenized using a TissueLyzer II bead mill (one 5 mm stainless steel bead per tube, 30 s-1 frequency for 3 minutes; Qiagen Inc. Hilden, Germany). The homogenates were incubated with 200 µL chloroform and centrifuged for 15 minutes at 12000 x g to isolate the protein-containing organic phase ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mL of culture were mixed with 6 mL of RNAprotect bacteria reagent (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... 3 mL samples were added to tubes containing 6 mL RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and vortexed ...
-
bioRxiv - Microbiology 2024Quote: ... used for DNA extraction of minipig blood and (NM-3) one negative control for the kit DNeasy PowerWater (Qiagen) used for the DNA extraction of water samples ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from pooled ipsilateral lumbar (L4-6) DRGs from one rat using the Qiagen RNeasy Mini Prep Kit (Qiagen, Valencia, CA) with on-column DNase digestion (Qiagen ...
-
bioRxiv - Developmental Biology 2024Quote: ... thresholds were used to prepare Reduced Representation Bisulfite Sequencing (RRBS) libraries using the Ovation RRBS Methyl-Seq System 1-16 (NuGen) and the EpiTect Fast DNA Bisulfite kit (Qiagen). Libraries were sequenced using the NextSeq500 platform (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA from the original material used for next-generation sequencing of the serum and passage 3 cultured MRI103 virus was used as the template for amplification using the One-Step Ahead RT-PCR kit (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... and Chl523R (5’ CCY YMC GTA TTA CCG CAG CT 3’) targeting the 16S rRNA gene on a QIAcuity One digital PCR device (Qiagen) as recommended by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Cell Biology 2022Quote: ... and organoids at the end of passage one subjected to two weeks of differentiation (n=3) using the RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: RNA was extracted from 3 dpf and 6 dpf cdipt mutant zebrafish and their wildtype siblings using RNAeasy (Qiagen). RNA samples were reverse transcribed into cDNA using the iScript cDNA synthesis kit (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... 6 (Qiagen) for additional analysis ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... Transcripts were stabilized by mixing 3 mL of cell cultures at the mid-log phase with 6 mL of RNAprotect Bacteria Reagent (Qiagen). Samples were immediately vortexed for 5 sec ...
-
bioRxiv - Immunology 2022Quote: ... A549-ORF7a and A549-ORF7b cells were seeded (3×10E5) in 6-well plates and lysed using RLT buffer for RNA isolation (RNeasy mini kit, Qiagen). Each sample was performed in triplicate ...
-
bioRxiv - Developmental Biology 2020Quote: E9.5 hindbrain spanning rhombomeres 1-6 were dissected from wild type and mutant embryos (n=3) to obtain total mRNA preparations (miRNeasy Micro Kit, Qiagen). Sequencing libraries were prepared following the SMART-Seq v4 Ultra Low Input RNA (TaKaRa ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Microbiology 2022Quote: ... we added 500 μL of TRIzol and one 3-mm glass bead to the microtubes with mosquitoes and then homogenized the samples in a TissueLyser® (QIAGEN, Hilden, Germany) at 30 Hz for 3 min ...
-
bioRxiv - Immunology 2023Quote: Whole livers were harvested at indicated timepoints and placed into a 7 ml homogenizer tube (Omni International Cat. No. 19-651) containing 3 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Spleens and single granulomas were harvested at indicated timepoints and placed into a 1 ml homogenizer tube (Fisher Brand Cat ...
-
bioRxiv - Genomics 2019Quote: ... True Methyl oxBS Module and genomic DNA according to manufacturers’ instructions (Qiagen, NuGen respectively). Bisulfite treated DNA served as templates to PCR-amplify three DNA fragments of 350-400 bp long that cover the entire MLH1 promoter region using ZymoTaq PreMix according to manufacturer’s instructions (Zymo Research) ...
-
bioRxiv - Genomics 2022Quote: ... One mL of Qiazol (Qiagen) was added to an aliquot of 150 μl of plasma per sample ...
-
bioRxiv - Immunology 2023Quote: ... One stainless steel bead (Qiagen) was added per sample and liver tissues were homogenized using the TissueLyser LT (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Barcoded libraries (One-step, Qiagen) were then run on MiSeq or NextSeq Illumina sequencers ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μl of media from each of 6 plant wells or media from 3 minimal media wells were pooled and stabilized in RNAprotect® Bacteria Reagent (QIAGEN) before performing RNA extraction using RNeasy Mini Kit (QIAGEN) ...
-
bioRxiv - Genetics 2022Quote: ... and non-inoculated G305-3M leaf segments collected along 10 different time points (0, 3, 6, 9, 12, 16, 24, 36, 48, 72 hpi) using the RNeasy Plant Mini Kit (Qiagen, Germany). The cDNA was synthesized from total RNA using a qScript™ cDNA Synthesis Kit (Quantabio ...
-
bioRxiv - Microbiology 2023Quote: ... 5.0 x105 293T cells were co-transfected with HIV-1 Env-expressing and HIV-1 Tat-expressing plasmids at a ratio of 1:6 using Effectene (Qiagen) and incubated for 48 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was then purified by mixing with beads at a 1:0.6 DNA/beads ratio followed by 3 washes with 70% ethanol and eluted with 30 μl of elution buffer (Qiagen Cat# 19086). Whole-exome sequencing was performed using the Mouse_Exome_Targets baitset from the Wellcome Sanger Institute pipeline ...
-
bioRxiv - Molecular Biology 2022Quote: Two independent siRNAs targeting YBX1 (Hs_YBX1-1 and Hs_YBX1-6 FlexiTube siRNA, Qiagen) and a non-targeting negative control siRNA (AllStars ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Immunology 2023Quote: ... Subsequent one-step RT-PCR (Qiagen) was performed using gene-specific primers listed in Supplementary Table S2.
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Barcoded libraries were made (One-step, Qiagen) and run on MiSeq or NextSeq Illumina sequencers ...
-
bioRxiv - Genetics 2019Quote: ... One-Step RT-PCR reagent (Qiagen # 210212) was used to create cDNA and then the cDNA was amplified by PCR ...
-
bioRxiv - Microbiology 2022Quote: One-Step Probe RT-qPCR kits (Qiagen) and CFX96 system/software (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... with one on-column DNase treatment (Qiagen). Total RNA yield was quantified using a Nanodrop (Thermo Scientific).