Labshake search
Citations for Qiagen :
1 - 50 of 1180 citations for 6 Chloro 2 iodotoluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: 2 × 105 cells were reverse-transfected in 6-well plates with Flexitube siRNA constructs (Qiagen) targeting KEAP1 (KEAP1_5 or KEAP1_8) ...
-
bioRxiv - Microbiology 2021Quote: ... 6 (Qiagen) for additional analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNAs were isolated from 6-month H19ΔICR/H19ΔICR and H19+/H19+ littermates (2 per genotype) using RNeasy Plus Mini Kit (Qiagen). Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina) ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells in 6-well plates were transfected with 2 μg pIRES2-eGFP or Trim-HA-NUP153 derivatives using Effectene (Qiagen). At 24 h post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: 3×106 cells from the day 8 of CD34+ HSPC and day 6 of HUDEP-2 erythroid differentiation were used for total RNA using RNeasy Mini Kit (Qiagen). For reverse transcription using Primescript RT reagent kit (Takara Bio Inc.) ...
-
bioRxiv - Cell Biology 2019Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates or in wells of a 6-well plate using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Immunology 2023Quote: ... in vitro derived Foxp3+ cells were harvested on day 2 and day 6 into Trizol and total RNA was isolated with miRNeasy Micro Kits (QIAGEN 217084) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA from 18 ONS cell samples (6 AD patients, 6 MCI and 6 HC) were extracted using Allprep universal kit (Qiagen cat. no. 80224). RNA-seq libraries were prepared using the Illumina TruSeq Stranded Total RNA library Prep Gold Kit (Illumina 20020598 ...
-
bioRxiv - Systems Biology 2020Quote: ... 6×10^6 PBMC from each sample were transferred directly to Quiazol regent (QIAGEN), resuspended and immediately aliquoted and stored at −80°C until RNAseq downstream processing ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... One million cells per well were seeded in 6 well plates in 2 mL growth medium the day before transfection and transfected with PolyFect (Qiagen, Düsseldorf, DE) using the manufacturers protocol (changing the medium to growth medium without hygromycin B and puromycin prior to transfection) ...
-
bioRxiv - Molecular Biology 2020Quote: 6 ml Ni-NTA (QIAGEN) was washed with 5 column volumes of wash buffer 1 (150 mM NaCl ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Genetics 2020Quote: ... coli strains expressing (His)6-Clr4 and (His)6-Swi6 and allowed to bind at 4°C overnight to Ni-NTA resin (Qiagen; binding capacity 5-10mg protein/ml resin) ...
-
bioRxiv - Microbiology 2023Quote: ... The SCGs cultured in 6-well dishes and one entire 6-well was harvested and pooled together for RNA isolation (RNeasy, Qiagen) per sample ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 µl Hi-Perfect transfection reagent (Qiagen, 301707), and 1 µl of the desired (20 µM ...
-
bioRxiv - Genomics 2022Quote: ... 400 nL of protease mix (6 μg protease (Qiagen, 19155), 6.25x NEBuffer 4 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 6 and 9 employing the RNeasy plant mini kit (Qiagen). RNA was quantified using Nanodrop (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... For MUS81 interference it was used FlexiTube HsMUS81 6 (Qiagen). SMARCAL1 was depleted using the MISSION esiRNA HUMAN SMARCAL1 (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2023Quote: ... 6 million PBMCs were lysed using QIAzol Lysis Reagent (Qiagen). Samples were stored at -80°C until RNA extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 µg C19orf43 (purified from E. coli BL21 through Qiagen Ni-TA agarose using standard procedures ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 mL of Ni2+-NTA slurry (Qiagen, Venlo, LI, Netherlands) were equilibrated in a gravity flow column with Wash Buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... UniSpike 6 (included in the QIAGEN miRCURY LNA RT Kit) to verify the efficacy of reverse transcription (RT ...
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested 6 h post-transfection and the extracted RNA (RNeasy, Qiagen) reverse transcribed to produce cDNA (QuantiTect ...
-
bioRxiv - Cell Biology 2020Quote: ... in the wells of 6 well plates (35mm) using Effectene transfection reagent(Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 6 and 9 hours of treatment using RNeasy Plus Mini Kit (Qiagen, 74134), and was reverse-transcribed to cDNA using Transcriptor First Strand cDNA Synthesis Kit with random primers (Roche ...
-
bioRxiv - Genetics 2019Quote: Raw sequence files (FASTQ) were imported into CLC Genomics Workbench (v.6; Qiagen) and mapped onto the human genome (GRCh37/hg19) ...
-
bioRxiv - Biophysics 2020Quote: ... The studies were carried out on a Rotor-Gene Q 6 plex (QIAGEN) instrument at a heating rate of 2 °C/min and a temperature range of 25-90 °C ...
-
bioRxiv - Molecular Biology 2022Quote: Two independent siRNAs targeting YBX1 (Hs_YBX1-1 and Hs_YBX1-6 FlexiTube siRNA, Qiagen) and a non-targeting negative control siRNA (AllStars ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 6 dpf larvae (RNeasy Plus Mini Kit; Qiagen) and reversed transcribed (iScript Reverse Transcription Supermix ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RPR2 (n=6) primary tumors was performed using RNeasy Mini Kit (Qiagen) with the standard protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The 6 PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) to eliminate byproducts.
-
bioRxiv - Genetics 2023Quote: RNA was extracted from 6-well plates using miRNeasy Mini Kits (QIAGEN 217004) with the inclusion of an on-column DNase digestion (QIAGEN 79254) ...
-
bioRxiv - Neuroscience 2024Quote: ... and the mouse hippocampal tissues (n=5-6/group; Qiagen, Germantown, MD, USA). The samples of the RNA (500ng/µL ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 6 µM and harvested 24 h later by adding RLT lysis buffer (Qiagen). Similarly ...