Labshake search
Citations for Qiagen :
1 - 50 of 2426 citations for 6 BROMO 2 4 CHLOROPHENYL 3 METHYLQUINOLINE 4 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Biochemistry 2019Quote: ... 3-4 mL of Ni-NTA superflow resin (Qiagen) were loaded onto a column and equilibrated with the resuspension buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... 5.6 x 105 cells were seeded in 4 ml DMEM in a 6-cm culture plate and transfected with targeting or control siRNA (Table 4) (from Qiagen) to a final concentration of 20 nM for each siRNA used ...
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Plant Biology 2020Quote: ... Magnetic beads (Dynabeads M-270 Carboxylic Acid) were activated and coated with ad hoc designed LNA probes (Qiagen), harboring an −NH2 group ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from approximately 100 EBs (differentiation day 2 and 3) or 25 EBs (differentiation day 4 and 5) using RNeasy Mini kit (Qiagen). 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated at 4 °C overnight with Ni2+-nitrilotriacetic acid resin (Qiagen) pre-equilibrated with buffer B ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease73 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Genetics 2020Quote: ... coli strains expressing (His)6-Clr4 and (His)6-Swi6 and allowed to bind at 4°C overnight to Ni-NTA resin (Qiagen; binding capacity 5-10mg protein/ml resin) ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Cancer Biology 2021Quote: ... cfDNA was extracted from approximately 4□ml of plasma (QIAamp Circulating Nucleic Acid kit, Qiagen) and then constructed into sequencing libraries with end repair ...
-
bioRxiv - Microbiology 2023Quote: Lungs from hamsters at 4 or 6 dpi were homogenized in PBS with TissueRuptor (Qiagen). A part of the whole lung homogenate was subjected to plaque assays for virus titration as described above ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from 4-6 dpf zebrafish larvae using the RNeasy Plus Micro Kit (Qiagen). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: Nucleic acids were isolated from 4 mL of plasma by using a QIAamp cfDNA/RNA kit (Qiagen 55184) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mL of fermentor culture was added to 4 mL RNAprotect Bacteria Reagent (Qiagen) and immediately vortexed for 10 sec ...
-
bioRxiv - Microbiology 2024Quote: ... resuspended in 2 mL salts mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen), and then incubated for 5 min at room temperature for stabilization before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Immunology 2022Quote: ... The supernatant was harvested at day 4 after transfection and incubated with Ni-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen). The purification was carried out using gravity flow column and eluted with imidazole-containing buffer as previously described57,58 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissues were weighed and homogenized in 4 volumes of water (4 µL of water/mg tissue, 4°C) using a bead beater (TissueLyser II, QIAGEN; Germantown, MD). Aqueous homogenates were profiled using four complimentary liquid chromatography tandem mass spectrometry (LC-MS ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from 3-4 two-week old gemmae using the RNeasy Plant kit (#74903, Qiagen) with RLT buffer supplemented with beta-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of bisDNA was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 2 μl of 10 μM primer mix (Methods Table 1) ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (20 mg of proteins/ml of resin ...
-
bioRxiv - Immunology 2021Quote: ... Skin samples were homogenized in a TissueLyser LT (Qiagen, 50 Hz, 2 times 4 minutes) using 5 mm stainless steel beads (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant obtained after high speed centrifugation (20 000 x g for 30 min at 4 °C) was loaded on a gravity nickel-nitrilotriacetic acid (Ni-NTA) metal affinity column (Qiagen), washed with 10 column volumes (CV ...
-
bioRxiv - Genomics 2021Quote: ... cfDNA extraction was performed using the QIAamp Circulating Nucleic Acid Kit using the 4-mL plasma protocol (Qiagen, product #55114). Prior to DNA elution ...
-
bioRxiv - Biochemistry 2019Quote: ... and the lysate was mixed gently with 4 ml (50% slurry) of nickel-nitrilotriacetic acid (Ni-NTA)-agarose resin (Qiagen) at 4°C for 1 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... we utilized 4 mL of plasma and cfDNA was isolated using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany). The concentration of cfDNA was determined using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... 45 min at 4 °C) and supernatant containing His-tagged proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) purification (Qiagen). Protein was eluted in a final elution buffer of 20 mM Tris pH 8.0 ...
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Biochemistry 2023Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from the leaves of 4-to-6-week old plants using the RNeasy Plant Mini Kit (Qiagen). RNA concentrations were quantified using a Qubit RNA BR Assay Kit (ThermoFisher ...