Labshake search
Citations for Qiagen :
1 - 50 of 2944 citations for 6 Amino 3 morpholin 4 ylmethyl indazole 1 carboxylic acid tert butyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... Magnetic beads (Dynabeads M-270 Carboxylic Acid) were activated and coated with ad hoc designed LNA probes (Qiagen), harboring an −NH2 group ...
-
bioRxiv - Genomics 2021Quote: ... Amino acid sequences were aligned using CLC Genomics Workbench 20.0.04 (QIAGEN, Aarhus, Denmark).
-
bioRxiv - Microbiology 2022Quote: ... Amino acid locations were confirmed through sequence alignment using MacVector and CLC Workbench (QIAGEN).
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Plant Biology 2021Quote: ... The complete amino acid sequences were aligned by the CLC Genomics Workbench software version 11.0.1 (QIAGEN) (default parameters with very accurate ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was isolated from CTi400 and N/TERT-1 cells using RNeasy Plus mini kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acid sequence alignments and a phylogenetic tree of CEC3 homologs were generated using CLC Genomics Workbench8 (QIAGEN bioinformatics).
-
bioRxiv - Microbiology 2023Quote: Sequences comparisons between 16S rRNA and bsh genes/BSH amino acid sequences were performed in CLC Genomics Workbench (Qiagen). 7α-HSDH sequence comparisons were performed using tblastn78 using the translated amino acid sequence from Clostridium absonum44.
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Genomics 2023Quote: ... 1µM Template-Switching Oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” prefixes a ribonucleic acid base and “+” prefixes a locked nucleic acid base, Qiagen) then incubated using a ThermoMixer C with the following conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Biochemistry 2019Quote: ... 3-4 mL of Ni-NTA superflow resin (Qiagen) were loaded onto a column and equilibrated with the resuspension buffer ...
-
bioRxiv - Microbiology 2021Quote: ... as well as the relative amino acid content of SLPMh were calculated using the CLC Main Workbench 20.0.1 (QIAGEN, Aarhus, Denmark). Conserved domains in the amino acid sequence of SLPMh were identified based on hidden markov models via the HHPred server (Söding et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Genetics 2020Quote: ... coli strains expressing (His)6-Clr4 and (His)6-Swi6 and allowed to bind at 4°C overnight to Ni-NTA resin (Qiagen; binding capacity 5-10mg protein/ml resin) ...
-
bioRxiv - Microbiology 2023Quote: The amino acid sequences of coronavirus spike orthologues were subjected to multiple alignment using CLC Workbench 7 (CLC Bio, Qiagen, Aarhus, Denmark). Protein sequence NCBI reference sequences for the indicated viruses are as follows ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mL of culture were mixed with 6 mL of RNAprotect bacteria reagent (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 5.6 x 105 cells were seeded in 4 ml DMEM in a 6-cm culture plate and transfected with targeting or control siRNA (Table 4) (from Qiagen) to a final concentration of 20 nM for each siRNA used ...
-
bioRxiv - Cancer Biology 2023Quote: Pathway analysis was performed to integrate the targeted amino acid results using the Ingenuity Pathway Analysis Software (IPA) version 70750971 (QIAGEN, Redwood City, USA). Metabolites strongly correlated with tumor weight were identified using Spearman’s rank correlation analysis ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from 1 or 4 ml of urine according to manufacturer recommendations (Qiagen Circulating Nucleic Acid Kit, Qiagen, Valencia, CA) and quantified using a Qubit fluorometer 3.0 (high sensitivity double-stranded DNA kit ...
-
bioRxiv - Biochemistry 2020Quote: ... at 4°C and the supernatant was loaded onto a 1 ml nickel nitrilotriacetic acid-agarose column (Ni-NTA, Qiagen, Hilden, Germany) previously equilibrated with the corresponding lysis buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated at 4 °C overnight with Ni2+-nitrilotriacetic acid resin (Qiagen) pre-equilibrated with buffer B ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Microbiology 2020Quote: ... The 6 × his-tagged proteins were purified using a nickel-nitrilotriacetic acid (Ni-NTA) agarose matrix (30250, Qiagen). Cell-free extracts were loaded on 0.5 ml Ni-NTA matrixes and incubated on a roller shaker for 2 h at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Cell Biology 2022Quote: ... A Locked Nucleic Acid (LNA) probe was used to detect centromere regions (5’-TTGGCTACACCATGAAAGCTT-3’; Qiagen). 20 μL of probe mix (250 nM LNA probe ...
-
bioRxiv - Microbiology 2023Quote: ... and the supernatant was added to 3 ml of Ni-nitrilotriacetic acid (NTA) superflow resin (Qiagen) and the mixture was applied onto a gravity drip column ...
-
bioRxiv - Cancer Biology 2021Quote: ... cfDNA was extracted from approximately 4□ml of plasma (QIAamp Circulating Nucleic Acid kit, Qiagen) and then constructed into sequencing libraries with end repair ...
-
bioRxiv - Microbiology 2022Quote: ... 3 mL samples were added to tubes containing 6 mL RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and vortexed ...
-
bioRxiv - Microbiology 2023Quote: Lungs from hamsters at 4 or 6 dpi were homogenized in PBS with TissueRuptor (Qiagen). A part of the whole lung homogenate was subjected to plaque assays for virus titration as described above ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from 4-6 dpf zebrafish larvae using the RNeasy Plus Micro Kit (Qiagen). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: ... purified nucleic acids were treated with 1-5 μl 1 mg/ml RNaseA (Qiagen) for 45 minutes at 37 °C to degrade RNA ...