Labshake search
Citations for Qiagen :
1 - 50 of 4057 citations for 6 4 Methyl 1 piperazinyl N 5 methyl 1H pyrazol 3 yl 2 1Z 2 phenylethenyl 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Biochemistry 2022Quote: IQN17 was crystallized at room temperature in a hanging-drop vapor diffusion system by mixing 0.3 μL of 15 mg/mL peptide with 0.3 μL of reservoir solution containing 0.1 M imidazole (pH 8.0) and 35 % 2-methyl-2,4-pentanediol (MPD) (Qiagen). Crystals were seen two days after trays were set up ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from approximately 100 EBs (differentiation day 2 and 3) or 25 EBs (differentiation day 4 and 5) using RNeasy Mini kit (Qiagen). 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Epitect Methyl II PCR Array System (Qiagen) was used to determine the CpG island methylation status of CDH1 (E-Cadherin) ...
-
bioRxiv - Neuroscience 2022Quote: EpiTect Methyl II PCR Primer Assay (Qiagen) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was isolated from liver and lung tissues (n=4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Mini Kit (Qiagen) and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... n=4 females [hybrid cross] and n=5 females [conspecific cross]) using the AllPrep RNA/DNA Mini Kit (Qiagen), and was stored at −80°C until sequencing ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Genetics 2022Quote: Total RNA was extracted from the stomach and pyloric caeca tissue samples stored at -80 °C (n = 4 for control and fly larvae, n = 5 for shrimp shell) using the RNeasy Plus Universal Kit (QIAGEN). RNA quality was assessed using a 2100 Bioanalyzer with the RNA 6000 nano kit (Agilent ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted from infected (n = 4) and control (n = 4) bAM samples using the RNeasy Plus Mini Kit (Qiagen) as previously described [91] ...
-
bioRxiv - Neuroscience 2021Quote: ... (n=3 biological replicates) and TACs (hGFAP::GFP-, CD133-, EGFR+, CD24-) (n=2 biological replicates) using the miRNeasy kit (Qiagen). miRNAs were pre-amplified and profiled using TaqMan® Array Rodent MicroRNA A Cards v2.0 A as specified by the manufacturer at the Genome Technology Center of New York University Langone Medical Center ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was isolated from HFC (n = 3) and LFC (n = 4) tumor samples using the RNeasy Plus Universal Mini Kit (QIAGEN, Valencia, CA) and RNA quality was confirmed using an Advanced Analytical Fragment Analyzer ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease73 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Molecular Biology 2020Quote: ... was purified from curd stomach milk collected from P7 offspring that were exposed to mCHD (n=4) or mHFD (n=4) using a combination of QIAzol and miRNeasy Mini Kit (217004; Qiagen, Toronto, ON, CA) as described previously (Izumi et al. ...
-
bioRxiv - Bioengineering 2021Quote: DNA contents in native/control kidneys (n = 4) and decellularized kidneys (n = 4) were measured using a Qiagen DNeasy Kit (Qiagen, Valencia, CA, USA). The tissues were initially minced and stored overnight at −80°C ...
-
bioRxiv - Physiology 2023Quote: DNA content in native/control kidneys (n = 4) and decellularized kidneys (n = 4) were measured using a Qiagen DNeasy Kit (Qiagen, Valencia, CA, USA). The tissues were initially minced and stored overnight at −80°C ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Blood Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... diluted in fresh culture media or left untreated (n = 4) for 6 h prior to harvesting RNA in RLT buffer (Qiagen) with added β-ME ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from d2 (n. 2 biological replicates) and d4 (n. 2 biological replicates) cells with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... True Methyl oxBS Module and genomic DNA according to manufacturers’ instructions (Qiagen, NuGen respectively). Bisulfite treated DNA served as templates to PCR-amplify three DNA fragments of 350-400 bp long that cover the entire MLH1 promoter region using ZymoTaq PreMix according to manufacturer’s instructions (Zymo Research) ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mL of fermentor culture was added to 4 mL RNAprotect Bacteria Reagent (Qiagen) and immediately vortexed for 10 sec ...
-
bioRxiv - Microbiology 2024Quote: ... resuspended in 2 mL salts mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen), and then incubated for 5 min at room temperature for stabilization before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Genomics 2020Quote: ... and AH (20 weeks) old C57/Bl6/J mouse hearts (n= 4-6/group) using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from TG and NTG mice (n=4/group) at 6 months of age using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... thresholds were used to prepare Reduced Representation Bisulfite Sequencing (RRBS) libraries using the Ovation RRBS Methyl-Seq System 1-16 (NuGen) and the EpiTect Fast DNA Bisulfite kit (Qiagen). Libraries were sequenced using the NextSeq500 platform (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... and the mouse hippocampal tissues (n=5-6/group; Qiagen, Germantown, MD, USA). The samples of the RNA (500ng/µL ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of bisDNA was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 2 μl of 10 μM primer mix (Methods Table 1) ...