Labshake search
Citations for Qiagen :
1 - 50 of 861 citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was extracted from alcohol-preserved tissues using the DNeasy Blood and Tissue kit (QIAGEN). Tlr genes were genotyped using a two-step approach ...
-
bioRxiv - Cancer Biology 2023Quote: ... After chloroform: isoamyl alcohol (24:1) extraction followed by purification (Qiagen RNeasy Mini Kit, 74104), the biotinylated RNA was resuspended in water and biotinylated-RNA was isolated using Dynabeads MyOne Streptavidin C1 magnetic beads (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unbound biotin was removed by performing a chloroform:isoamyl alcohol extraction using MaXtract High Density tubes (Qiagen). RNA was isopropanol precipitated and resuspended in water ...
-
bioRxiv - Microbiology 2022Quote: ... Unbound biotin was removed by performing a chloroform:isoamyl alcohol extraction using MaXtract High Density tubes (Qiagen). RNA was isopropanol precipitated and resuspended in water ...
-
bioRxiv - Microbiology 2023Quote: ... Unbound biotin was removed by performing a chloroform:isoamyl alcohol extraction using MaXtract High Density tubes (Qiagen). RNA was isopropanol precipitated and resuspended in water ...
-
bioRxiv - Genomics 2021Quote: ... DNA purification was done with phenol/chloroform/isoamyl alcohol extraction followed by chloroform extraction using MaxTract tubes (Qiagen). DNA was precipitated with ethanol after addition of 20 µg glycogene ...
-
bioRxiv - Immunology 2023Quote: ... Bacterial gDNA were extracted from the liquid cultures using phenol:chloroform:isoamyl alcohol and then purified further with the QIAquick PCR Purification kit (Qiagen). Prevotella-specific 16S rRNA gene primers (gPrevo-F and R-)14 (Table S3 ...
-
bioRxiv - Immunology 2023Quote: Bacterial genomic DNA from frozen stool samples was extracted using phenol:chloroform:isoamyl alcohol and then purified further with the QIAquick PCR Purification kit (Qiagen)45 ...
-
bioRxiv - Systems Biology 2023Quote: Fragments were purified by adding 300µL phenol:chloroform:isoamyl alcohol (25:24:1 v/v) and sample to a phase lock tube (Qiagen #129046), and spun down at 16,000g for 3 minutes ...
-
bioRxiv - Microbiology 2019Quote: Total RNA was extracted from frozen samples using two acid phenol-chloroform-isoamyl alcohol extractions and immediately purified using the RNEasy MinElute kit (Qiagen). Ribosomal RNA (rRNA ...
-
bioRxiv - Immunology 2019Quote: ... gDNA was extracted from frozen tumor cells using previously optimized (Chen et al., 2015) ammonium acetate and alcohol precipitation procedure to isolate gDNA with AL buffer (Qiagen) substituted for the initial cell lysis step ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted from muscle or whole animal using phenol-chloroform-isoamyl alcohol extraction or MagAttract HMW DNA Kit (Qiagen), and further purified using NucleoBond columns (Machery Nagel) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Yeast DNA was first extracted with Phenol-Chloroform-Isoamyl alcohol before precipitating with isopropanol and resuspending in elution buffer (EB; Qiagen). YAC containing yeast were assessed by PCR using Q5® Hot Start High-Fidelity 2X Master Mix (M0494S) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction was mixed with an equal volume of chloroform/isoamyl alcohol (24:1) and separated with a phase-lock tube (Qiagen) by centrifugation (14000 rpm ...
-
bioRxiv - Genetics 2023Quote: All cDNA samples were pooled into two groups corresponding to cases (alcohol drinkers) and controls (non-drinkers) and then assayed using the Serum/Plasma Focus PCR panel (Qiagen). This commercially available microarray platform contains 179 LNA miRNA primer sets of miRNAs that have been commonly found in human plasma ...
-
Phenogenomic resources immortalized in a panel of wild-derived strains of five species of house micebioRxiv - Evolutionary Biology 2023Quote: Genomic DNA was isolated from frozen (−80 °C) or alcohol-preserved muscle or spleen tissues using DNeasy Blood & Tissue Kits (Qiagen). High-quality DNA aliquots were next-generation sequenced at the Edinburgh Genomics facility using HiSeq X technology ...
-
bioRxiv - Microbiology 2021Quote: ... The pooled RNA was precipitated by isopropyl alcohol with addition of glycogen followed by additional clarification with RNeasy MinElute Cleanup kit (Qiagen, Germany). NEBNext rRNA Depletion kit (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA was extracted once with 350 μL Phenol:Chloroform:Isoamyl Alcohol (25:24:1) in a phase-lock tube (Qiagen cat. no. 129046) and centrifuged 5 min at 16,000xg followed by extraction with 350 μL chloroform ...
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted with 1 volume of 25:24:1 phenol-chloroform-isoamyl alcohol and purified with QIAquick PCR Purification Kit (QIAGEN 28104). Libraries were prepared with the Ovation Ultralow V2 DNA-Seq Library Preparation Kit (NuGEN (Redwood City ...
-
bioRxiv - Microbiology 2024Quote: ... followed by a single extraction with an equal volume of chloroform-isoamyl alcohol (24:1) using Qiagen Maxtract High Density medium (Qiagen, Hilden, Germany). NaCl was added to 300 mM and DNA was precipitated with 2.5 volumes of 100% EtOH at −20°C overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... and oligo 5 (Q4) 5’-CACCGAGCTCTTCGCCGAGTA-3’ (Qiagen, SI03058272).
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 5× One-step RT-PCR buffer (QIAGEN), 10 μL Triton-x100 (0.3% ...
-
bioRxiv - Cell Biology 2023Quote: ... siCASK #5 (Qiagen cat# SI02223368 ...
-
bioRxiv - Microbiology 2021Quote: ... 5-plex (Qiagen, Germany), the QIAcuity One-Step Viral RT-PCR Kit (Cat No ...
-
bioRxiv - Cell Biology 2020Quote: ... + 5 μM TSO (Qiagen). Amplification of cDNA (22 amplification cycles ...
-
bioRxiv - Cell Biology 2021Quote: ... 5×10^5 EpCAM+ve cells were lysed in 350μL RTL Buffer (Qiagen) containing 143mM β-Mercaptoethanol (aided by cell searing via passage ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4C (Qiagen, SI05163977), and 20 nM HIF1A Flexitube GeneSolution siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4B (Qiagen, SI00449764), 5 nM siKDM4C (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Genetics 2021Quote: ... 5 mM Multiplex-Kit (Qiagen) and HPLC water to a total volume of 10 μL per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 uL EB buffer (QIAGEN) was added to each well and mixed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 μl RLT (79216, Qiagen) was added ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 μL of Ni-NTA (Qiagen) slurry was added and the solution was incubated with light agitation at 4 °C for 50 min ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 5 μL Qiagen master mix (Qiagen Type-It Microsatellite Kit ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 5 μL 10X PCR buffer (Qiagen), and nuclease-free water to a final volume of 50 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Genomics 2021Quote: ... containing 5 µl RLT plus (Qiagen) with 1% v/v β-mercaptoethanol (Biorad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...