Labshake search
Citations for Qiagen :
1 - 50 of 2031 citations for 3 1 Phenylethylamino propane 1 thiol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... and thiols and disulphides were extracted in 1 mL of ice-cold 0.1 M HCl using a Tissue-Lyser (Qiagen, Hilden, Germany) and two 3-mm glass beads (30 Hz ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 μg DNA ratio using Effectene transfection reagent (Qiagen). Recombinant luciferase-expressing viruses capable of a single round of replication were released into the cell medium and were harvested 48 h later ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 µg DNA ratio using effectene transfection reagent (Qiagen). Recombinant ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL (50U) of high-concentration klenow 3’-5’ exo-polymerase (Qiagen) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... The cleared lysate was then incubated with 3 mL of 1:1 Ni-NTA agarose slurry (Qiagen, product number 30210) for 1 hour ...
-
bioRxiv - Immunology 2021Quote: ... homogenized in 1 ml PBS by bead beating (3 mm steel ball, 25 Hz for 1 min in a TissueLyser (Qiagen)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were diluted in TE buffer and treated with 1 μL of 20 mg/mL RNAse A (Applichem) for 1 h and 3 μL of Proteinase K (Qiagen) for 2 h at 40C ...
-
bioRxiv - Biochemistry 2022Quote: ... the best diffracting crystal for the 14-3-3σ Clu3/pS197 complex grew in condition G2 (0.2 M NaBr, 100 mM BisTris propane pH 7.5, 20% PEG 3350) of PACT screen (Qiagen, Hilden, Germany). Crystals were mounted in nylon loops directly from crystallization drops and flash frozen in liquid nitrogen without additional cryoprotection ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA of the 20 Jan and 3 Mar 2021 samples (1/3 pellet) was extracted with the DNeasy UltraClean Microbial Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Plant Biology 2020Quote: Reduced His-tagged PRX-IIE (3 mg) or PRX-IIE C146S (3 mg) were bound to 1 mL Ni-NTA resin (Qiagen, Hilden, Germany) and used as affinity matrix ...
-
bioRxiv - Developmental Biology 2020Quote: ... rhesus fibroblast cell line (n=1), pri-CTB (n=1, rh090419) and TSCs (n=3 rh121118, rh052318, cy091318) using a FlexiGene DNA Kit (Qiagen, cat no: 51206) and quantified using a Nanodrop™ One Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... the tissue was ground using a tissue lyser (Qiagen, 3 min at 300 s-1) in 200 µL 500 mM Tris pH 9 by adding a metal ball (diameter 5 mm) ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-month-old zebrafish (1 fish/sample) using the RNeasy Mini Kit (Cat. No. 74104; Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Whole RNA (1-3 μg total per 10 μL volume) was isolated using RNAeasy mini kit (QIAGEN) or TRIzol (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Pelleted cells were resuspended in 1 ml of Na2CO3 buffer containing 3 µg/ml RNase A (Qiagen) and incubated at 50°C for at least 4 h ...
-
bioRxiv - Microbiology 2022Quote: ... beat-beading tubes were filled 1/3 with beads and soaked overnight in 500 μl buffer RLT (Qiagen). Tubes were spun at full speed and excess buffer removed ...
-
bioRxiv - Microbiology 2020Quote: Each dissected compartment (legs and thoraxes) was homogenized individually 3 x 1 minute at 30 Hertz using TissueLyser (Qiagen) and glass beads (#11079110 ...
-
bioRxiv - Neuroscience 2021Quote: ... miR-67 (miR control) or empty vector at a ratio of 1:3 using a lipofection protocol (Effecten, Qiagen) and processed at DIV15 ...
-
bioRxiv - Immunology 2024Quote: Total RNA from roughly 1-3 million thawed patient PBMCs was extracted using a RNeasy Mini Extraction kit (Qiagen) and reverse transcribed to cDNA using oligo-DT primers and the iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Bioengineering 2023Quote: Each body part (legs and thorax) was homogenized individually for 3 × 1 minute at 30 Hertz using TissueLyser (Qiagen) and glass beads (#11079110 ...
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 9-10 mL of Buffer BB (1/3 of the lysate volume, From QIAGEN Plasmid Plus Midi Kit) was added ...
-
bioRxiv - Bioengineering 2020Quote: Around 250 mg of each produce sample was cut into 1-3 mm pieces using a scalpel and then processed with the DNeasy Powersoil Pro kit (Qiagen) to isolate 50μL of eluted DNA ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was purified 1-3 dpi from mock- or POWV-infected hBMECs or hPCs using RLT lysis buffer and RNeasy columns (Qiagen). Purified RNA was quantitated ...
-
bioRxiv - Genomics 2022Quote: ... Formalin-Fixed Paraffin-Embedded (FFPE) tissue (3 samples) and fresh frozen tissue (1 sample, QiaAmp Blood mini kit, QIAcube, QIAgen). Two samples are reference samples (NA24385 and NA12892 ...
-
bioRxiv - Genomics 2022Quote: ... the supernatants were mixed with Sigma HIS-Select Nickel Affinity Gel (at a ratio of 3:1) equilibrated in lysis buffer before being added into a polypropylene column (Qiagen). After extensive washing with a cold lysis buffer ...
-
bioRxiv - Cancer Biology 2022Quote: Spheroid and monolayer samples (technical replicates n=3) of MUC-1 and NCI-H295R cells were processed for RNA extraction using the RNeasy Mini kit (Qiagen), followed by DNA removal (TURBO DNA-free™ Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted from pooled (n=10) embryonic zebrafish and pooled (n=3) adult (> 1 year) heart samples by QIAGEN RNEasy Lipid Tissue Extraction kit according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... The LNA gapmers for lnc-FLii-1 and lnc-LSAMP-3 were designed and purchased along with negative control LNA from Qiagen. For transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Microbiology 2023Quote: ... round 1 and 3 virus infections of GeCKO-A549 cells using the midi gDNA extraction kit (Qiagen, Germantown, MD, USA). The sgRNA’s DNA copies were PCR amplified from the extracted gDNAs for next generation sequencing (Fig 1) ...
-
bioRxiv - Pathology 2024Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 µl of diluted template cDNA (1:3, nuclease-free water) per real-time PCR reaction (10 µl – SYBR Green PCR kit, Qiagen, 204143) was used to assay specific transcript abundance (CFX96 Real-Time System ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from homogenized lysate containing a range of 3×103 to 1×105 cells per sample using a ll Prep DNA/RNA Mini kit (Qiagen, #80204). RNA was purified and concentrated using RNAClean XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μL of plasma/EV suspension were mixed with 1000 μL Qiazol and 1 μL of a mix of 3 synthetic spike-in controls (Qiagen, Germany). After a 10-minute incubation at room temperature ...
-
bioRxiv - Genetics 2020Quote: ... 1 µl 1 mg/ml Carrier RNA (QIAGEN), 1 µl 10% SDS ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized 2-3 fecal pellets in 1 mL H2O using ceramic beads (NucleoSpin, Macherey–Nagel, Dueren, Germany) and a TissueLyser (Qiagen, Hilden, Germany), mixing the sample for 3 × 30 s at 4,500 rpm with a 10 s cooling break (< 0°C) ...