Labshake search
Citations for Qiagen :
3001 - 3050 of 3706 citations for Monocyclohexyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from 1 × 106 cells using RNeasy Plus Mini Kit (Qiagen) with genomic DNA removal ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA (1 μg) was reverse transcribed using the Quantitect Reverse Transcription Kit (Qiagen). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription of 1 μg RNA was performed using Omniscript RT kit (Qiagen, #205111). CLN3 transcript was amplified ...
-
bioRxiv - Immunology 2024Quote: ... ∼1000 macrophages were sorted into 75µL of RLT buffer (Qiagen, containing 1% beta-mercaptoethanol), vortexed for 1 min and immediately frozen (−80°C) ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Microbiology 2021Quote: ... The qPCR reaction mixture (10 μL) comprised 1× Rotor-Gene SYBR green PCR mix (Qiagen), 500 nM of each primer ...
-
bioRxiv - Genomics 2020Quote: RNA was purified from approximately 1 × 107 CHM13 cells using an RNeasy kit (Qiagen; 74104) and prepared into Iso-Seq libraries following a standard protocol68 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unbound Biotin-HPDP was removed by chloroform/isoamylalcohol (24:1) extraction in MaXtract tubes (Qiagen). RNA was precipitated with 10th volume of 5M NaCl and 1 volume of isopropanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The backbone was extracted from a 1% agarose gel using QIAquick Gel Extraction Kit (Qiagen) and the minigene insert was cleaned up using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2019Quote: ... following the manufacturer’s instructions and treated twice with DNase I (1 unit/µg RNA, Qiagen). The RNA concentration was quantified using nanodrop2000 (Thermo Fisher ...
-
bioRxiv - Plant Biology 2019Quote: ... with 1 min shaking at 25 Hz in the Tissue Lyser II (Qiagen, Hilden, Germany). Ground tissue was stored at −80 °C ...
-
bioRxiv - Genetics 2019Quote: ... DNA from FFPE sample 6005-1 was extracted using QIAamp DNA FFPE Tissue Kit (Qiagen). Genomic DNA and RNA were extracted from peripheral blood leukocytes from patient 6003 and from a non-HHT control individual using the Gentra PureGene Blood Kit (Qiagen ...
-
bioRxiv - Immunology 2019Quote: ... Purified RNA (1 μg) was reverse-transcribed to cDNA using RT2 First Strand Kit (Qiagen, Hilden ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA was isolated from 1×106 tumor cells using DNeasy Blood & Tissue Kit (Qiagen). BCMA and CS1 loci amplicons ...
-
bioRxiv - Neuroscience 2020Quote: ... then converted to cDNA using 1 µg RNA and a QuantiTect Reverse Transcription kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... MCD360-1 and the F1 progenies using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA). Equal amounts of DNA were pooled from 30 responsive as well as 30 non-responsive progenies for the INF1 recognition phenotype and 29 responsive and 30 non-responsive individuals for the SCR74 response phenotype ...
-
bioRxiv - Bioengineering 2021Quote: RNA was extracted from ∼1 M cells using the QIAGEN RNeasy Mini Kit (QIAGEN 74104). A total of 36 samples were prepared ...
-
bioRxiv - Neuroscience 2020Quote: ... with all primers listed in Supplementary Table 1 and then purified (QIAGEN, PCR purification kit). Before nick translation ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 μg total RNA was reverse transcribed using the miScript II Reverse Transcription kit (Qiagen) according to the manufacturer’s instructions (Jay and Ciaudo ...
-
bioRxiv - Physiology 2021Quote: ... 20 μL reactions consisted of 1×QuantiFAST reaction mix containing ROX reference dye (Qiagen, Germany), 0.66 µM of forward and reverse primers ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the sample at a 1:1000 dilution in RNAse-free water (Qiagen, 129112) (2017) ...
-
bioRxiv - Plant Biology 2022Quote: ... The lower part of the root (1 cm) was collected directly in RLT buffer (QIAGEN) and frozen in liquid nitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... a 1:2000 dilution of a mouse anti-Penta-His Alexa Fluor 647 conjugate (Qiagen) was used.
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was prepared from 0.5-1 μg RNA using a Quantitect Reverse Transcription Kit (Qiagen) and diluted to 2.5 ng/mL in DEPC-treated water ...
-
bioRxiv - Cancer Biology 2022Quote: Cells from knockdown control or shWDR5-1 group were harvested with QIAzol Lysis Reagent (Qiagen) and homogenized using QIAshredder tubes (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... Targeted PCR products were purified from 1% agarose gel using QIAquick Gel Extraction Kit (Qiagen) and Sanger sequenced (Eurofins Genomics ...
-
bioRxiv - Genomics 2019Quote: ... The solution was extracted with chloroform : isoamylalcohol (24:1) using MaXtractTM High Density Tubes (Qiagen) and precipitated with a 0.7 volume of isopropanol using a sterile glass rod to collect the DNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... and DNA extracted using a Qiagen EZ-1 instrument using the DNA Investigator kit (Qiagen). Swab heads were processed according to Qiagen protocols ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from approximately 1 million cells using AllPrep DNA/RNA Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Genomic DNA (1 μg) was treated with bisulfite using an Epitect Bisulfite kit (Qiagen, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Total RNA was isolated from 1×107 cells using the RNeasy Mini Kit (QIAGEN, Germany) following the protocol for enzymatic digestion of cell wall followed by lysis of spheroplasts ...
-
bioRxiv - Physiology 2021Quote: ... Reverse transcription of total RNA (1 μg) was done with QuantiTect Reverse Transcription kit (Qiagen), and cDNA quantified using LC Fast start DNA Master SYBR Green I Mix (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: ... The cDNA fragment encoding residues 1-386 was cloned into the pQE-30 vector (QIAGEN). The 6×His-C2CD6 (aa 1-386 ...
-
bioRxiv - Cell Biology 2020Quote: ... the supernatant was incubated for 1 hour at 4°C with Ni-NTA-agarose (Qiagen), washed several times with lysis buffer and the protein was eluted by incubation for 3 hours with lysis buffer containing 500 mM imidazol ...
-
bioRxiv - Genetics 2021Quote: ... by mixing 1 μl of RT product with 10 μl of SYBR qPCR Mastermix (Qiagen) containing the appropriate primers (345 nM of forward primer and 345 nM of reverse primer) ...
-
bioRxiv - Genomics 2020Quote: ... Beads were dried at room temperature for 1 minute and 50uL of EB buffer (Qiagen) was added slowly on top of the beads ...
-
bioRxiv - Microbiology 2021Quote: ... 20 μL reactions consisted of 1×QuantiFAST reaction mix containing ROX reference dye (Qiagen, Germany), 0.66 µM of forward and reverse primers ...
-
bioRxiv - Immunology 2020Quote: ... 0.125 μl 20 μM SmarterR reverse primer (30) and 1 μl PCR-grade H2O (Qiagen). The amplification was performed in a thermal cycler (lid temperature 98°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... for 1 hour and purified by agarose gel extraction (MinElute Gel Extraction Kit, Qiagen #28606). Gibson cloning was done with NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621L ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA (1 μg) was first reverse-transcribed using the QuantiTect Reverse Transcription kit (Qiagen). 20 ng of total cDNA were then subjected to qRT-PCR using TaqMan Gene Expression Master Mix and pre-designed TaqMan probes (all from Applied Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: ... Products were extracted from a 1% agarose gel using the QIAquick Gel Extraction Kit (Qiagen). Libraries were pooled and paired-end 150 base pair sequencing reads obtained by sequencing on a HiSeq4000 platform (Novogene) ...
-
bioRxiv - Cell Biology 2022Quote: ... Products were extracted from a 1% agarose gel using the QIAquick Gel Extraction Kit (Qiagen). TruSeq sequencing adapters were added to mutant fragments by PCR using HCM1 specific primers fused to the TruSeq universal adapter or unique TruSeq indexed adapters ...
-
bioRxiv - Genetics 2022Quote: ... loaded on a 1% agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen).
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated from 1 μg of RNA with the QuantiTect Reverse Transcription Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... All samples were subjected to a 1-hour DNAse treatment (Qiagen RNase-free DNase kit), and final elution volume was 20 μl ...
-
bioRxiv - Immunology 2024Quote: ... Illumina compatible libraries were generated using the Qiagen Q1ASeq 1-step amplicon kit (Qiagen, #180419), and sequencing was performed on the Illumina MiSeq platform using 2×250 paired end reads with a goal of generating 5,000 – 10,000 reads per sample ...
-
bioRxiv - Developmental Biology 2023Quote: ... following the manufacturer’s instructions and treated twice with DNase I (1 U/μg RNA, Qiagen). The RNA concentration was quantified using the Nanodrop2000 (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: RNA was isolated from 1×106 MEL cells with the RNeasy Plus kit (Qiagen, 74134). RNA was reverse-transcribed using the Superscript III First-Strand Synthesis System (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... Four-cell and morula stage embryos were collected into 1 × TCL buffer (Qiagen, Cat# 1070498) containing 1% 2-mercaptoethanol at 46 and 72 h post-fertilization ...
-
bioRxiv - Molecular Biology 2022Quote: ... Complementary DNA was synthesized from 1 μg of RNA using the QuantitTect RT kit (Qiagen). Quantitative PCRs (qPCR ...