Labshake search
Citations for Qiagen :
2451 - 2500 of 3706 citations for Monocyclohexyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM DTT using a TissueRuptor (Qiagen). The homogenate was then centrifuged 5 min at 2,500 x g at 4°C and the supernatant transferred to a new tube on ice followed by further homogenisation using a 27G needle and syringe ...
-
bioRxiv - Cancer Biology 2020Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1) DNeasy PowerLyzer PowerSoil Kit (QIAGEN®), 2 ...
-
bioRxiv - Immunology 2021Quote: ... 1-unit HotStarTaq Plus (QIAGEN, Cat#: 203607), 190 nM 3’ primer pool ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: Myosin-18A siRNA – #1 CACGAACTGGAGATGGATCTA (Qiagen SI04273668), #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: ... 25 nM of S1PR1 #1 (Qiagen, #SI00376201) 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... 1 μL of Q-Solution from Qiagen® and H2O ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μM barcode LNA RT primer (Qiagen), 1U/μL RiboLock RNase inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 25 mM MgCl2 (Qiagen) and 1 ul of the primer mix (40 uM of the Forward primer ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μL GlycoBlue coprecipitant (Qiagen; AM9515). RNA was precipitated after holding overnight at -80°C and centrifugation ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-RGS-His (Qiagen, 1:2000, 34610), anti-Myc (ChromoTek ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 μl Type-it Master Mix (Qiagen), 0.17 μM of either FAM or VIC ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... containing 1 × Master Mix (Qiagen Multiplex Kit), 0.4 μg/μL of BSA ...
-
bioRxiv - Microbiology 2021Quote: ... transferred to the laboratory (within 2 hours) on ice and immediately processed for DNA extraction using the DNeasy PowerSoil kit (Qiagen, Valencia, CA, USA) according to manufacturer protocols ...
-
bioRxiv - Cancer Biology 2019Quote: ... First-strand cDNA was prepared from 2 µg of cellular RNA in a total reaction volume of 20 µL using the reverse transcriptase Omniscript (QIAGEN, Mississauga, ON, Canada). After reverse transcription ...
-
bioRxiv - Microbiology 2021Quote: Cellular total RNA was prepared from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Microbiology 2021Quote: ... were selected with a P<0.05 and 2-fold change in gene expression and used for network/pathway analysis using Ingenuity Pathway Analysis (IPA; Qiagen, Valencia, CA, USA) as described previously (5).
-
bioRxiv - Evolutionary Biology 2019Quote: ... Microsatellites were co-amplified in multiplex PCR (Table 2) with a Thermocycler T Gradient machine (Biometra, Goettingen, Germany) using the Qiagen® Multiplex PCR Kit (Qiagen, Hilden, Germany). Forward primers were 5’-labeled with fluorescent dyes HEX ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Genomics 2021Quote: ... Quantification of ACE2 transcript levels was performed by preparing total RNA from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Molecular Biology 2022Quote: Viral RNA was extracted from serially diluted and the 4 different media SARS-CoV-2 samples using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH, Hilden, Germany). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA extraction was performed from 25 mg (±2 mg) of arthropod powder with Qiagen Dneasy® Blood & Tissue extraction kit (Qiagen, Hilden – Germany) following the manufacturer’s protocol (see Sire et al ...
-
bioRxiv - Genetics 2024Quote: ... PCR products were run in a 2% agarose gel and the correct band (around 200 bp) was purified with QiaQuick gel extraction Kit (QIAGEN, catalog number 28706) (at least 2 columns ...
-
bioRxiv - Plant Biology 2024Quote: ... Tissue samples were ground by shaking with glass beads in a TissueLyser II (Qiagen, 2 pulses of 30 s each at 28Hz shaking). Leaf powder was suspended in 1.2 ml of cold nuclear isolation buffer (20 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid expressing VSV-G or HIVKB9 envelope glycoproteins were cotransfected at the mass ratio of 9:1 (9 Hi.fate / 1 Env) using Effectene (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... or WT-Cav-1 (1 µg) plus EphB1-Y600F-YFP (2.5 µg using Superfect transfection reagent (cat #301305, Qiagen). Media was replaced 6 h after transfection with fresh DMEM media containing 10% FBS ...
-
bioRxiv - Physiology 2020Quote: ... insulin-like growth factor 1 receptor (Igf1r) and sirtuin 1 (Sirt1) gene promoters were designed using the Pyromark Assay Deisgn 2.0 software (Qiagen). PCR and sequencing primers are provided in Supplementary Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 10-day-old whole seedlings grown on 1/2X MS media containing 1% sucrose and 0.8% agar (Plant RNeasy kit (Qiagen)) ...
-
bioRxiv - Systems Biology 2023Quote: ... x mg solid matrix were mixed with five times the μl amount of ACN:water (1:1, v/v) and homogenised with a TissueLyser II (30 Hz, 10 min; Retsch Qiagen). After a short centrifugation (2 min ...
-
bioRxiv - Genomics 2021Quote: ... The eluates were mixed with guanidine– HCl to a final concentration of 6 M and incubated with Ni-NTA sepharose (Qiagen, 100 μl of slurry per sample) o/n at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was isolated from 10 ml cultures of yeast strains and purified with an RNeasy kit (Qiagen). The RNA was prepared for sequencing using the TruSeq Stranded Total RNA Sample Prep adaptor kit (Illumina) ...
-
bioRxiv - Genomics 2020Quote: Nucleic acids were isolated from 4 mL of plasma by using a QIAamp cfDNA/RNA kit (Qiagen 55184) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... The partially decalcified nodule was then immersed in 1 mL of a digestion buffer with final concentrations of 0.45 M EDTA and 0.25 mg/mL Proteinase K (Qiagen) and rotated at 37°C overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... resuspended in 50 mM sodium citrate buffer containing 10 µl of RNase A (20 mg/ml, Qiagen 76254) and incubated for 2 hours at 50°C ...
-
bioRxiv - Genetics 2020Quote: ... plasmids were isolated from 200 mL of these cultures using Qiagen Plasmid Plus Purification kits (Qiagen #12963, #12965). The remaining 200 mL of the overnight cultures were spun down ...
-
bioRxiv - Systems Biology 2020Quote: Three milliliters of cells from mid-log phase cultures were mixed with 6 mL RNAprotect Bacteria Reagent (Qiagen). Samples were mixed immediately by vortexing for 5 s ...
-
bioRxiv - Biochemistry 2020Quote: ... the supernatant was applied to a 0.1 ml column of Ni2+-NTA Superflow resin (Qiagen Cat No. 30410) and protein was purified using the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 20 mM imidazole was added to the supernatant and incubated with 5 mL of Ni-NTA resin (Qiagen) with a stirring magnet at 4°C for 30 min ...
-
bioRxiv - Biophysics 2022Quote: ... The suspension was spun down at 16,000 r.c.f at 4 °C for 30 min and the supernatant was applied 5 ml Ni-NTA resin (Qiagen)/ L culture medium ...
-
bioRxiv - Neuroscience 2019Quote: ... we added 0.6 μL Proteinase K stop solution to each tube (5 mg/mL Proteinase K solution (Qiagen), 50 mM EDTA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.5 mL of overnight culture was spun down and resuspended in 250 µL P1 buffer with RNAse (Qiagen) and 200 µL of glass beads (Sigma ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 0.6 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture (1 ml beads per 1 l expression culture was used in case of Drosophila BiP ...
-
bioRxiv - Immunology 2019Quote: ... Red blood cells were removed by treating the cells with 5 ml Red Blood Cell Lysis buffer (Qiagen) for 4 min ...
-
Alzheimer’s patient brain myeloid cells exhibit enhanced aging and unique transcriptional activationbioRxiv - Neuroscience 2019Quote: ... FACS-isolated cell populations were spun at 5,000 rcf for 5 minutes and resuspended in 0.35 ml Buffer RLT from Qiagen RNeasy Micro kit ...
-
bioRxiv - Microbiology 2021Quote: ... PBS/G was replaced with PBS/G containing 0.2 mg/mL proteinase K (Qiagen N. V., Hilden, Germany) or various concentrations of sodium azide ...
-
bioRxiv - Genetics 2019Quote: ... the filter was compressed inside of the microcentrifuge tube using a pipette tip and the supernatant was transferred to a clean 0.5mL (NaOH extraction) or 1.5 mL microcentrifuge tube (magnetic beads and QIagen).
-
bioRxiv - Molecular Biology 2022Quote: ... cfDNA was extracted from 0.5 ml of plasma/serum using the QIAmp DNA Mini Blood kit (Qiagen, CA), performed according to the ‘‘Blood and body fluid protocol’’ and our own detailed protocol [37] ...