Labshake search
Citations for Qiagen :
201 - 250 of 10000+ citations for Cyclic GMP cGMP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... cells were collected from plates on the day noted and RNA was purified using the RNeasy mini prep kit (Qiagen), following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... yeast plasmid DNA was extracted from 5x107 cells harvested off of galactose and final glucose plates of replicates 2 and 3 using Qiaprep Spin Miniprep Kit (QIAGEN). We amplified the 200-bp repair template region from the initial E ...
-
bioRxiv - Immunology 2024Quote: BMDM treated in 6-well plates were washed twice with PBS before total RNA purification using the RNeasy kit (Qiagen) following the manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2024Quote: ... kanamycin-positive colonies were selected from the agar plate and plasmids were extracted using the MiniPrep isolation kit (Qiagen, USA). The cloned construct was eventually confirmed using Sanger sequencing.
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from cell lines grown in 6-well plates or from cell pellets using the RNAeasy Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: Total RNA was purified from single wells of >85% confluent six-well plates using the RNeasy Plus mini kit (Qiagen), and an additional DNase I step was used to remove genomic DNA ...
-
bioRxiv - Microbiology 2024Quote: DNA extraction from cultured treponemes propagated in 6-well plates following transformation and expansion was performed using the QIAamp DNA mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... LF/LF = 5 mice from two cages over two experiments) using the DNeasy PowerSoil Kit (Qiagen, Germantown, MD). Modifications to the standard protocol included a 10-minute incubation at 65°C immediately following the addition of the lysis buffer and the use of a bead mill homogenizer at 4.5 m/s for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA-Seq libraries were prepared from 5 ng total RNA using the NEB Next RNA Ultra Kit (QIAGEN) with poly(A ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA from approximately 25 EBs at day 5 of differentiation was isolated using RNeasy Mini kit (Qiagen) and quantified by NanoDrop (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... total DNA from 5 × 105 J-Lat cells was purified using Qiagen blood mini kit (Qiagen, Hilden, Germany) and quantitated spectrophotometrically ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was isolated from 5 × 105 cells with the AllPrep© DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA for expression analyses was extracted from 5 day-old protonemata using a RNeasy Plant Mini Kit (Qiagen). Genomic DNA removal and cDNA synthesis were performed with a Quantitect Reverse Transcription kit (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from 5×106 cells per sample using the AllPrep DNA/RNA/miRNA Universal Kit (QIAGEN) according to manufacturer’s recommendations with additional DNase I treatment for RNA extraction ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from the Sterivex filters (i.e., 0.22–5 μm size fraction) using an AllPrep DNA/RNA Mini Kit (80204; Qiagen) with a modified protocol ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from 5-10 snap-frozen larvae with the RNeasy Mini kit (Qiagen cat no. 74104) and reverse-transcribed using QuantiTect Reverse Transcription kit (Qiagen cat no 205311 ...
-
bioRxiv - Immunology 2022Quote: Total RNA from ~ 5 × 105 neutrophils (CD45+Lin-CD11b+Ly6G+) was isolated with the RNeasy micro kit (Qiagen) and RNA quality was checked with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR amplification was carried out in 5 µl reactions using the QIAGEN Multiplex PCR Kit (QIAGEN, Germany). Each sample reaction contained 10–20 ng of genomic template DNA ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA from 5-day-old whole plants was extracted using the RNeasy Plant Mini Kit (Qiagen, 74904). For RNA-seq ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 5-10 g of soil per sample with the DNeasy PowerMax Soil Kit (Qiagen) and used for short read and long read sequencing ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). The remaining 95 mL of culture was combined with 40.7 mL 50% glycerol (v/v) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Glycerol was added to the remaining culture to a final concentration of 15% (v/v ...
-
bioRxiv - Immunology 2023Quote: RNA was purified from at least 5 x 104 CD4+ T cells using the RNeasy Micro kit (Qiagen). cDNA was synthesized using the SuperScriptTMVILOTMcDNA synthesis kit (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: Ni-NTA HisSorb plates (Qiagen) were coated with 50ng/well of S1 proteins (all from Sino Biological ...
-
bioRxiv - Microbiology 2021Quote: Ni-NTA HisSorb plates (Qiagen) were incubated with soluble gH/gL/gO complexes tagged with 6-His overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... using Powerbead Pro Plates (Qiagen) with 0.5mm and 0.1mm ceramic beads ...
-
bioRxiv - Cell Biology 2023Quote: ... siCASK #5 (Qiagen cat# SI02223368 ...
-
bioRxiv - Neuroscience 2022Quote: E3 and E4 primary microglia were plated at 5×106 cells/well in 6-well plates and RNA was extracted from the cells using the RNEasy Plus Mini Kit (Qiagen #74136) and converted to cDNA using High-Capacity RNA-to-cDNA kit (Thermo #4387406 ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA from cells in a single well of a 6-well plate was isolated using the RNeasy Plus Mini Kit (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: RNA from myotubes grown in 6-well plates in conditions described above was isolated using the RNeasy Micro Kit from Qiagen (#74004). Quality of RNA was assessed by using a Bioanalyzer 2100 and samples were submitted for library preparation and deep sequencing to the Molecular biology core facility at the Dana Farber Cancer Institute ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Total RNA was isolated from iPSC-SNs seeded in 6-well plates using a RNeasy Mini Kit (Qiagen, Redwood City, CA) and reverse transcribed into cDNA using a SuperScript VILO cDNA Synthesis kit (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: Cells were grown to 80% confluence in a 6-well plate before RNA was extracted using standard RNA extraction protocol (RNAeasy Mini Kit, Qiagen, #74104). cDNA synthesis was performed by mixing 1μg of RNA with qScript® cDNA Synthesis Kit (Quantabio ...
-
bioRxiv - Microbiology 2021Quote: DNA from plate-well pools of the progenitor collection was isolated with a DNeasy 96 Blood &Tissue Kit (Qiagen, Cat. #69582) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Total RNA was isolated from cells grown in six-well plates at 70–80% confluency with an RNA extraction kit (Qiagen #74104). cDNA was synthesized using a sensiFAST cDNA synthesis kit (Meridian Bioscience #BIO-65053) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Total RNA was extracted from iPSC-SNs seeded in 12-well plates using RNeasy Mini Kit (74106, Qiagen AB, Stockholm, Sweden) with DNase digestion (79256 ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... Colonies were transferred to 96-well plates and grown until a sufficient number of cells was reached for genomic DNA (DNeasy Blood & Tissue Kit; Qiagen, #69504) and protein extraction ...
-
bioRxiv - Microbiology 2024Quote: ... the plates were imaged to verify expression of the fluorescent reporter before column-based isolation of RNA (Qiagen, RNeasy Mini Kit) with on-column DNA digestion ...
-
bioRxiv - Cell Biology 2019Quote: ... brefeldin A (2.5 μg/mL) and MG132 (2.5 μM) for 24 hr prior to RNA isolation with RNAeasy Mini Kit (Qiagen). One μg of purified RNA was reverse transcribed into cDNA using the Protoscript II Reverse Transcriptase kit (New England Biolabs) ...
-
bioRxiv - Genetics 2021Quote: ... The 10 μL reaction was carried out with 40 ng genomic DNA and 0.2 μM of each primer and 5 mM Multiplex PCR Kit (Qiagen). Cycling conditions were identical for both directions with 95°C 15:30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was stopped by adding 2.5 uL of 0.5M EDTA pH 8 and transposed DNA was purified using Qiagen MiniElute PCR purification kit (Qiagen). Purified DNA was amplified using the following condition ...
-
bioRxiv - Immunology 2022Quote: For RT product measurements DNA was extracted from 5×105 infected cells using the DNeasy Blood & Tissue kit (QIAgen) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... n=4 females [hybrid cross] and n=5 females [conspecific cross]) using the AllPrep RNA/DNA Mini Kit (Qiagen), and was stored at −80°C until sequencing ...
-
bioRxiv - Cell Biology 2021Quote: RNA from 5-10 million NK cells treated overnight with indicated conditions was extracted using Rneasy Plus kit (Qiagen). Samples were prepared for Illumina sequencing following the manufacturer’s protocol using the TruSeq® stranded total RNA with rRNA depletion using Ribo Zero TM Human/Mouse/Rat ...
-
bioRxiv - Microbiology 2021Quote: ... 100 μl of total RNAs were extracted from 5 × 105 replicon cells using RNeasy mini kit (Qiagen, Gaithersburg, MD). 2□μl of each sample was used to assess RNA quality using Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... For RT product measurements DNA was extracted from 5×105 infected cells using the DNeasy Blood & Tissue kit (QIAgen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA were extracted from roots 5 days after germination using the RNeasy® Plant Mini kit (Qiagen #74904) according to the manufacturer’s instructions ...