Labshake search
Citations for Qiagen :
2401 - 2450 of 3706 citations for Monocyclohexyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned-up using 1:1 of SPRI beads and eluted in 30µl elution buffer (Qiagen). The resulting amplicons were assayed on the Fragment Analyzer System (Agilent) ...
-
bioRxiv - Neuroscience 2023Quote: ... Flow-through was mixed 1:1 with 70% ethanol and passed through a RNeasy Mini column (Qiagen, #74104). After centrifugation ...
-
bioRxiv - Genetics 2020Quote: ... The eluates were mixed with guanidine-HCl to a final concentration of 6M and incubated with Ni-NTAsepharose (Qiagen, 100 μl of slurry per sample) o/n at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: DNA isolation and quantification was performed as previously described43,44,68 using a high molecular weight genomic DNA purification kit according to the manufacturer’s protocol (QIAGEN Genomic tip either 20/G or 100/G) and Quant-iT Picogreen dsDNA quantification ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted from 50 ml LB from an overnight culture using a plasmid midi kit (Qiagen). Successful genomic DNA extraction was confirmed by PCR with primers gp41 inner F (5’-CAAGAGCAAAGAACCGACG-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was conducted using specific 10x QuantiTect primers diluted in 1.1 mL TE pH 8.0 (Qiagen). The genes that were analyzed were Adcy1 (QT00386421) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 mL were collected and used for plasmid extraction using a QI-Aprep Spin Miniprep kit (QIAGEN). Extracted plasmids were eluted in 30 μL of elution buffer and stored at −20 °C until use.
-
bioRxiv - Microbiology 2021Quote: ... Plasmids were isolated from 5 mL of overnight liquid culture using QIAprep Spin Miniprep Kit (Qiagen, Germany) and the presence of mutations was confirmed by Sanger Sequencing.
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was loaded onto a gravity column containing 5 ml of 50% Ni-NTA resin (Qiagen) pre-equilibrated with 40 ml lysis buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 mL TRIzol added and homogenization was performed by bead beating using a TissueLyser II (Qiagen, Germany) with 0.5 mm glass beads (Scietific Industries Inc. ...
-
bioRxiv - Microbiology 2019Quote: Bacterial DNA was isolated from 10 mL of urine using the QIAamp Viral RNA Mini Kit (Qiagen) according to manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell lysates were clarified using ultracentrifugation and loaded on a 15 ml Ni-NTA Superflow column (QIAGEN) and washed with 7 column volumes of 20 mM HEPES-KOH pH 7.5 ...
-
bioRxiv - Genomics 2022Quote: ... The samples were cooled to room temperature and 30 μL of 10 mg/mL RNase A (QIAGEN) was added and the samples were incubated at 37°C for 1 hour ...
-
bioRxiv - Systems Biology 2022Quote: ... at which point 650 μl of the culture was mixed with 1.3 mL RNAProtect Bacterial Reagent (Qiagen) and frozen according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... The soluble fraction was purified using either 10 mL nickel-chelating column or Strep-Tactin column (Qiagen). The N-terminal His-SUMO tags were cleaved from the eluted protein by TEV protease overnight and removed by passing through a second nickel column ...
-
bioRxiv - Cell Biology 2022Quote: ... Condensin I was bound to Glutathione Sepharose 4B beads (Cytiva) in a 5 mL polypropylene column (Qiagen) using GST- tagged mSMC4 and eluted by PreScission Protease (Cytiva ...
-
bioRxiv - Neuroscience 2021Quote: ... RNAsin Plus 400 units/ml (Fischer Scientific PRN2615) followed by resuspension in Qiagen RLT buffer (Qiagen 79216) with 1% 2-mercaptoethanol (Sigma Aldrich M6250).
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were cooled to room temperature and treated with 2.5 µl of RNAse A (10mg/mL, Qiagen) at 37°C for 2 hours ...
-
bioRxiv - Microbiology 2021Quote: ... 14 mg/ml) were screened for crystallization using the 384 conditions of the JCSG Core Suite (Qiagen) on our custom-designed robotic CrystalMation system (Rigaku ...
-
bioRxiv - Genomics 2021Quote: DNA was extracted from the donors’ peripheral blood (5 ml) using DNeasy Blood & Tissue Kit from QIAGEN according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Ligated chromatin was de-crosslinked by incubation with 4μL proteinase K (20mg/mL, Qiagen, Cat. 19131, Germany), overnight for 65°C and 300 RPM) ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was incubated for 2h at 4°C with 5 ml of Ni-NTA agarose (Qiagen) pre-equilibrated in wash buffer 1 WB1 ...
-
bioRxiv - Microbiology 2020Quote: ... at which point 1.5 mL of culture samples were collected and resuspended in RNAprotect Bacteria Reagent (Qiagen) and then QIAzol Lysis Reagent (Qiagen ...
-
bioRxiv - Genetics 2020Quote: Germline DNA was isolated from 1.5 ml peripheral blood using the QIASymphony DSP DNA Midi kit (QIAGEN), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... and 10 mg/mL proteinase K) and DNA clean up (MiniElute reaction clean up kit, 28204, Qiagen). qPCR was performed using mPer2 and Wnt3a primers ...
-
bioRxiv - Plant Biology 2022Quote: ... the clear supernatant was incubated for 4 h with 1.5 ml Ni-NTA agarose (Qiagen, Hilden, Germany) previously washed with 6 ml of distilled H2O and equilibrated with 6 ml of binding buffer (150 mM NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... the soluble fraction was loaded onto a Ni-NTA agarose mini-column (0.2 mL) (Qiagen, Hilden, Germany). The column was washed with 10 column volumes of At buffer (50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Microbiology 2022Quote: ... Four wells were then harvested at the appropriate growth stage and combined with 4 mL RNAprotect (Qiagen) to generate each replicate ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared lysate was applied to 4 ml bed volume Ni-NTA Agarose beads (Qiagen, cat. No. 30210) for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from 13 ml of the culture using a DNeasy Blood & Tissue kit (Qiagen) according to the manufacturer’s instructions for Gram-negative bacteria ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from 1.8 ml of culture with a DNeasy ultraclean microbial kit (Qiagen, Germany) according to the manufacturer’s instructions and stored in 10 mM Tris buffer at pH 8 and -80 ⁰C until paired-end reads of 2 x 150 bp were sequenced on a NextSeq 500/550 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA of isolated colony were purified from 7.5 ml of culture (DNeasy Blood and Tissue – Qiagen) with an additional step of cell lysis with microbeads (Precellys Evolution) ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of field-saturated peat were added to 2.5 volumes of Lifeguard buffer (Qiagen, Maryland, USA), transferred out of the field on ice in a cooler ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was passed two times over a column with 1.5 mL of Ni2+-NTA resin (Qiagen), washed with 50 bed volumes of wash buffer (20 mM HEPES-KOH ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 0.2 ml of each BAL using the QIAamp DNA Blood Mini Kit (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... 25 mM NaCl in UltraPure distilled water) with 0.4 mg/ml Proteinase K (QIAGEN N.V., Venlo, NL). Homogenized samples were incubated at 37 °C for 1.5 h followed by 98 °C for 2 min ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant from the second spin was incubated with 3 mL of Ni-NTA agarose beads (Qiagen) for 30 minutes at 4°C in the cold room ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was passed through a 5 mL column volume (CV) of Ni-NTA agarose resin (Qiagen: 30250). The column was then washed with 10 CV of His binding buffer (50 mM NaH2PO4 ...
-
bioRxiv - Genomics 2024Quote: Peripheral Blood samples (2.5 ml) were drawn from each volunteer in a PAXgene tube (Qiagen cat# 762165) followed by total RNA (including miRNA ...
-
bioRxiv - Genomics 2024Quote: Peripheral Blood samples (2.5 ml) were drawn from each volunteer in a PAXgene tube (Qiagen cat# 762165) followed by total RNA isolation using an RNA isolation kit (Qiagen cat# 763134 ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were resuspened in 500 µL 1X PBS and 25 µL RNase A solution (10mg/ml) (Qiagen). Following incubation ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA) (Qiagen, Hs_PLCE1_1, SI00115521); negative control siRNA (UUCUCCGAACGUGUCACGUdTdT ...
-
bioRxiv - Microbiology 2020Quote: ... 1× Qiagen Multiplex Master Mix (QIAGEN, Germany) and 5 μL of template DNA in a 15 μL reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Genomics 2019Quote: ... and 1 U Taq DNA polymerase (Qiagen). A positive control of DNA extracted from commercially available Agaricus bisporus provided by Dr ...
-
bioRxiv - Genomics 2019Quote: ... and 1 U Taq DNA polymerase (Qiagen). The fungal-specific ITS1F/ITS4 and bacteria-specific 341F/805R primer pairs were used for each sample in two independent PCR reactions ...
-
bioRxiv - Genetics 2019Quote: ... 1×106 cells using RNeasy Kit (Qiagen), followed by DNase digestion using TURBO DNase (Thermo Fisher) ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 1 unit of HotStar Plus Taq (Qiagen), 200 nM of each primer ...