Labshake search
Citations for Qiagen :
2251 - 2300 of 3706 citations for Monocyclohexyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was then incubated with 5 mL of Ni-NTA agarose beads (Qiagen), pre-equilibrated in lysis buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Eluted DNA was reverse cross-linked and treated with 0.2 mg/ml proteinase K (Qiagen) for 2 h at 60℃ and heat inactive at 95 for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... 10 mM imidazole) and was added to 8 mL Ni-NTA resin (Qiagen, Hilden, Germany) preequilibrated with lysis buffer and rocked for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The filtered lysate was then passed over a 5 mL Ni-NTA Superflow column (Qiagen). Protein elution was carried out with a linear gradient of modified buffer B (20 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Biochemistry 2024Quote: ... The filtered lysate was then passed over a 5 mL Ni-NTA Superflow column (Qiagen). The column was washed extensively with buffer A and subsequently ...
-
bioRxiv - Biochemistry 2024Quote: ... The filtered lysate was then passed over a 5 mL Ni-NTA Superflow column (Qiagen). Protein elution was carried out with a gradient of buffer B ...
-
bioRxiv - Biochemistry 2024Quote: ... and 0.1% (v/v) β-mercaptoethanol was mixed with 5 mL Ni-NTA resin (Qiagen) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... the supernatant was loaded onto a 5-mL column of Ni-NTA agarose (Qiagen, Inc.) pre-equilibrated with buffer A ...
-
bioRxiv - Plant Biology 2019Quote: ... Total genomic DNA was extracted from 100 mg of fresh or frozen leaf tissue using the Qiagen DNeasy Plant Mini Kit (Qiagen, Valencia, California, USA) or a modified version of the CTAB protocol of Kubisiak et al ...
-
bioRxiv - Cell Biology 2019Quote: ... The tissue was ground in liquid nitrogen and 100 mg of the resulting powder used for RNA extraction as per manufacturer’s instructions (Qiagen RNeasy kit, Cat # 74904). The extracted RNA was treated with amplification-grade DNase I (ThermoFisher ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Brain parts were stored in 100 µL of Trizol™ in -80 °C for later RNA extraction using RNAeasy Mini Extraction Kit™ (Qiagen, Germany) according to the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA from 100 mg of the inoculated and uninoculated residual soil samples were extracted using the PowerSoil® DNA Extraction kit (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2019Quote: ... The PCR mixture contained 0.2 μM of each primer and 40 ng of bacterial DNA in a total volume of 100 μL (HotStar Taq Master Mix Kit, Qiagen, Valencia, CA, USA) (60).
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from approximately 100 mg of Arabidopsis roots or shoots using the RNeasy Plant Mini Kit (Qiagen, Cat. No. 74904). RNA samples were treated with DNaseI (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: Bacterial genomic DNA was extracted separately from caecal tissue (∼100 mg) and caecal contents (∼200 mg) using a QIAamp Fast DNA Stool Mini kit (QIAGEN, Valencia, CA, USA) following the manufacturer’s pathogen detection protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... The frozen tissue samples (∼ 100 mg weighed into a tube with fresh weight recorded) were homogenized in a TissueLyser II bead mill (Qiagen; Cat. No. 85300) for 1 min at 20 Hz without thawing out ...
-
bioRxiv - Microbiology 2024Quote: ... Viral DNA was purified and extracted from 100 μL of DNase I-treated culture supernatant using a QIAamp DNA Blood Mini Kit (QIAGEN GmbH, Hilden, Germany). To quantify viral DNA copies ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... The aqueous phase was collected and mixed at a 1:1 ratio with 70% ethanol (Qiagen). RNA was isolated from this mixture using the RNeasy MinElute Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1 μl 10X Buffer (Qiagen). PCR products were digested for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from infected or mock-treated Caco-2 cells using the Qiagen RNAeasy Plus Extraction Kit (Qiagen, Hilden, Germany). For quantifying the SARS-CoV-2 genome abundance in mock and infected samples ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 viruses were purified from the clinical samples by using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The preparations were analyzed by real-time RT–PCR testing for the determination of viral titers of SARS-CoV-2 by standard curve analysis ...
-
bioRxiv - Genomics 2019Quote: ... 200 μl lysis buffer were used per organoid for homogenization at 12,000 x g for 2 min in a QIAshredder Column (Qiagen, Hilden, Germany) after lysis and prior to addition of 70% ethanol ...
-
bioRxiv - Microbiology 2019Quote: We carried out RNA extraction on a litter aliquot of 0.2 g for shrub and 0.5 g for grass using RNeasy PowerSoil Total RNA Kit following manufacturer instructions (Qiagen, Hilden, Germany). Due to a high amount of organic compounds co-extracted from shrub litter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We extracted RNA from a total of 348 individuals across two early developmental stages (2 days post fertilization (dpf) and 8 dpf) using RNeasy Mini Kits (Qiagen, Inc.). For 2 dpf libraries ...
-
bioRxiv - Microbiology 2020Quote: ... Each 10 μL uPCR reaction contained 2 μL of DNA template with 1x QuantiTect Multiplex PCR No ROX mastermix (Qiagen™), 0.4 μM each primer ...
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...
-
bioRxiv - Microbiology 2021Quote: A total of 2 x 105 Vero E6 or HEK293ACE-2 cells were seeded 24 hours before transfection with one of the following siRNAs pools (Qiagen SMARTpool): siSTT3A (#GS3703) ...
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted using enzymatic lysis and mechanical disruption of the cells and purified with the RNeasy mini kit (Protocol 2, Qiagen, USA). The RNA standard (25ng ...
-
bioRxiv - Cancer Biology 2021Quote: ... or CRTC3 or control sgRNA (Supplementary Table 2) were transfected into 293FT cells together with packaging plasmids pMD2.G and pSPAX2 using Effectene transfection reagent (Qiagen #301425). The viral supernatants were collected at 48 ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... The clinical Samples (cervical smear) for the HPV DNA test were processed using HPV Test Hybrid Capture® 2 protocol (QIAGEN). Samples with relative light units (RLU ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from a minimum of 2 × 106 sorted MDSCs or nonMDSCs using an RNAeasy Mini Kit (Qiagen, Germantown, MD). RNA sequencing was performed by GENEWIZ (South Palinfield ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Cell Biology 2019Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates or in wells of a 6-well plate using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Epidemiology 2020Quote: ... Then a steel ball was added and samples were crushed twice during 2 min at 30 Hz/s with the Tissue Lyzer (Qiagen, Germany). 450 µL of fresh PBS 1X were added to the samples ...
-
bioRxiv - Genetics 2019Quote: ... The whole body of a single insect was homogenized in a PCR well containing 50 μl of the Lysis & Binding Solution and zirconia beads (ø 2 mm; Nikkato) in TissueLyser II (QIAGEN) at 25 Hz for 30 s ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was isolated from 2 g of homogenized material from frozen needles using the DNeasy Plant Maxi Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions ...