Labshake search
Citations for Qiagen :
151 - 200 of 1812 citations for 5 chloro 2 hydroxyacetophenone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... total RNA (2.5-5 μg) was extracted from BM mononuclear cells obtained by Ficoll-Paque gradient centrifugation using the miRNeasy kit (Qiagen) and depleted of ribosomal-RNA (Ribo-Zero™ rRNA Removal Kit ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCGTCATCAGGATTGGCAA and probe 5’-TGGGTGTCTGCTTTGGAACA were used in a one-step qRT-PCR reaction with either Quantifast reagents (Qiagen) for tissue RNA or LightCycler 480 RNA Master Hydrolysis Probes (Roche ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... total DNA was extracted from males (N = 5) and females (N = 5) of each genotype using the DNeasy Blood & Tissue kit following manufacturer protocol (Qiagen). Illumina libraries were prepared using the Nextera DNA Flex Library Preparation Kit (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... An 80 μL sample of the supernatant was transferred to a new tube and incubated with 5 μL of 5 mg/mL Proteinase K (QIAGEN) for 1 h at 60°C ...
-
bioRxiv - Immunology 2024Quote: ... and brain) homogenates collected from mice at 5 dpi and 5 dpc were generated using the Tissue Lyzer II (Qiagen). Briefly ...
-
bioRxiv - Neuroscience 2024Quote: Isolated dorsal striatal microglia (n = 5-7 per condition) were centrifuged for 5 min at 600xg and resuspended in RLT plus buffer (Qiagen) for extraction and purification of total RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reactions were incubated for 15 min at 60°C and then terminated by adding 1 μL 5 M NaOH to degrade RNA and heating at 95 °C for 5 min followed by neutralization with 1 μL 5 M HCl and one round of MinElute column clean-up (Qiagen). The R1R DNA adapter was adenylated by using a 5’ DNA Adenylation kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA from dorsal mouse skin was isolated from 5 control and 5 transgenic GRK2 eKO animals with RNAEasy Mini kit (#74104, Qiagen), following manufacturer instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... 5-10 μg RNA was DNAse treated (Qiagen) and rRNA was depleted (MICROBExpress ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 mm diameter stainless steel beads (QIAGEN) were added to each sample pool ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... and 5-mm stainless-steel beads (Qiagen #69989) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL Proteinase K (20 mg/mL, Qiagen) and 100 µl 10% SDS (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... in 5-ml polypropylene columns (no. 34964; Qiagen), washed with 50 mM Na2HCO3 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and 5-mm stainless steel beads (Qiagen #69989). RNA purification was performed using the NucleoSpin RNA kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2021Quote: ... in a 5 ml tube (Qiagen, DNAse/RNAsefree). The sediment samples were kept at 4 °C until the next day and then stored at −80 °C ...
-
bioRxiv - Immunology 2020Quote: ... 5×106 PBMCs were resuspended in RLT (Qiagen) and incubated at room temperature for 10 min prior to storage at –80°C ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Physiology 2020Quote: ... with 5 mm beads in RLT buffer (Qiagen) containing 1% β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... + 5% beta-mercaptoethanol using a bead mill (Qiagen). Samples were heated at 95° for 5 minutes to denature proteins ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5 mm diameter stainless steel beads (Qiagen) and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of 2U/μL Turbo DNase (Qiagen), and 1 μL of 10 mg/mL RNase A (Qiagen) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 mm stainless steel beads (Qiagen, #69989). Lysates were incubated for 2 h at 37°C protected from light ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM primers and 1 μl DNA template ...
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM Primer and 1 μl DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl Polyfect Transfection Reagent (Qiagen, catalog # 301105) was added ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with 5-mm stainless steel beads (Qiagen #69989). RNA extraction was carried out with the NucleoSpin RNA kit (Macherey-Nagel ...
-
A conserved RNA switch for acetylcholine receptor clustering at neuromuscular junctions in chordatesbioRxiv - Developmental Biology 2024Quote: ... 5 U/μL HotStarTaq Plus DNA polymerase (Qiagen) (0.4 μL ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Immunology 2022Quote: ... The middle and inferior right lobes were weighted and homogenized with PBS (1:5 w/v) using a 5 mm stainless steel bead (Qiagen, USA) and a TissueLyser LT (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...