Labshake search
Citations for Qiagen :
1151 - 1200 of 3612 citations for 6 Chloro 2 4 chlorophenyl N N dimethylimidazo 1 2 α pyridine 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The supernatant was then purified using a modified PB buffer and eluted using 2 washes in 18 μl buffer EB (QIAGEN) - with 3 min of incubation time at 37°C (Dabney et al ...
-
bioRxiv - Genetics 2023Quote: ... Whole blood was collected in 2% SDS Queens lysis buffer [23] and genomic DNA was extracted using a DNeasy Blood & Tissue Kit (Qiagen). All research was approved by the Institutional Animal Care and Use Committee at Columbia University (AC-AAAW6451) ...
-
bioRxiv - Genomics 2023Quote: ... to the eluted samples and digestion was carried out for 2 hours at 55°C followed by PCR purification (Qiagen). Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Preparation Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Microbiology 2023Quote: RNA was isolated from 2 h and 10 h RPMI-grown and macrophage-internalized Cg cells using the RNeasy kit (Qiagen), followed by DNase I digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... gDNA wipeout buffer was used to remove Genomic DNA for 2 minutes at 42°C and cDNA was synthetized with the QuantiTect Reverse Transcription Kit (Qiagen). qPCR was performed with PowerUp SYBR Green Master Mix using the StepOnePlus Real-Time PCR system ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA of subclones from a 12-well plate along with 2 million parental cells were extracted using DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... RNA from CD4+ T cells (2×106 cells per condition) was extracted by using the RNeasy Plus Mini kit (QIAGEN). Extracted total RNA was quantified using the Qubit broad range RNA assay ...
-
bioRxiv - Neuroscience 2024Quote: ... with 0.9 x tissue mass of lysis buffer (1x RIPA buffer with 2% SDS and 2x protease inhibitor cocktail) and TissueRuptor II (Qiagen) homogenization ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 mg of frozen brain was taken per mouse sample and lysed with 0.9 x tissue mass of lysis buffer (1x RIPA buffer with 2% SDS and 2x protease inhibitor cocktail) and was homogenised using a TissueRuptor II (Qiagen). Zebrafish larvae were similarly extracted ...
-
bioRxiv - Molecular Biology 2023Quote: Bulk-RNA free of genomic DNA for RT-qPCR analysis was extracted from cell pellets (≤ 2 x 106 cells) using the RNeasy plus spin-column purification kit (Qiagen) and performed using the Qiacube liquid handler (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were sorted directly into 2-Mercaptoethanol-containing RLT buffer and RNA was extracted using a RNeasy Mini kit (Qiagen). The cell populations used for RNA sequencing are summarized in Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... preceded by a 10-minute bead-beating step at 30 Hz in 2 ml e-matrix tubes (MP Biomedical, USA) using a Tissuelyser II (Qiagen). Molarity and fragment-length distribution of the extracts were measured using a Tapestation ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was isolated from kidneys of three independent biological samples for each age (E17.5, 2 months) and genotype using an RNeasy Mini Kit (Qiagen 74104) with on-column DNAse I treatment ...
-
bioRxiv - Biophysics 2023Quote: ... The soluble extracts were applied to 2 ml columns of nickel-nitrilotriacetic acid agarose (Ni-NTA) (QIAGEN catalogue no. 30210) that had been equilibrated with lysis buffer ...
-
bioRxiv - Genomics 2023Quote: Total DNA from enhancer screening library transduced HUDEP-2 cells was isolated using the DNeasy Blood & Tissue kit (Qiagen, 69504) and the enhancer inserts were PCR amplified using the following primers:
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from the root tip (2 cm apex) of the primary root using the RNeasy Plant Mini Kit (QIAGEN). RNA-seq was performed by the Montpellier GenomiX Platform (MGX ...
-
bioRxiv - Plant Biology 2024Quote: ... from infected leaf material or from urediniospores of non-target rust species (Table 2) with the DNeasy Plant mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... approximately 2×106 cells per well were washed with cold PBS and lysed using Buffer RLT (Qiagen, catalog no. 79216). RNA extraction was performed according to the manufacturer’s protocol (RNeasy Mini Kit ...
-
bioRxiv - Genomics 2024Quote: ... The amplicon library pools were isolated based on size by gel electrophoresis using a 2% agarose gel and then purified using QIAEX II Gel Extraction Kit (QIAGEN) and using 30uL of QIAEX II beads for each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 8 liver samples (2 from each lobe) were obtained on necropsy and processed with the DNeasy Blood and Tissue Kit (QIAGEN) as per the manufacturer’s instructions to isolate genomic DNA ...
-
bioRxiv - Genetics 2024Quote: ... DNA samples (70–80 oocytes and 7–10 blastocysts per sample) were subjected to bisulfite conversion through 2 µg carrier RNA (QIAGEN). Nested PCR was performed using EpiTaq HS with the primers listed in Supplementary Table 4 ...
-
bioRxiv - Immunology 2024Quote: ... Expression of target ncRNAs in CH12F3 and primary B cells were inhibited by 2 µM miRCURY LNA miRNA Inhibitors (339131, Qiagen), anti-miR-5099 (GGAGCACCACATCGATCTAA-FAM) ...
-
bioRxiv - Immunology 2024Quote: ... Overexpression of miR-5099 in CH12F3 was achieved by transfecting 2 µM of miR-5099 miRCURY LNA miRNA mimic (Qiagen) by electroporation using Lonza 4D-Nucleofector and cell line SF kit following manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... The filtrate was transferred to ultra-clean 2 mL tubes and 280 µL were collected for nucleic acid extraction using the QIAamp Viral RNA mini kit (Qiagen). The extract was eluted in a final volume of 40 µL and stored at -80 °C.
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was extracted from the mouse blood sampled after feeding the mosquitoes (Barcode input 2) using DNeasy Blood and Tissue Kit (Qiagen). The parasite gDNA was extracted from the infected mosquito midguts 14 days post-infection (Barcode output ...
-
bioRxiv - Physiology 2024Quote: ... was mechanically homogenised in TRI reagent with a 5 mm steel bead at 30 Hz for 2 x 30 s (TissueLyser II, Qiagen) then centrifuged for 10 min at 10,000 g ...
-
bioRxiv - Cancer Biology 2021Quote: Whole RNA (1-3 μg total per 10 μL volume) was isolated using RNAeasy mini kit (QIAGEN) or TRIzol (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Pelleted cells were resuspended in 1 ml of Na2CO3 buffer containing 3 µg/ml RNase A (Qiagen) and incubated at 50°C for at least 4 h ...
-
bioRxiv - Cell Biology 2019Quote: siRNAs used were as follows: Kif5b#3 (target sequence 5′-CAGCAAGAAGTAGACCGGATA-3′; Qiagen SI00176050), Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′ ...
-
bioRxiv - Bioengineering 2024Quote: ... the 3×Flag-MCS fragments in LV3-SFFV-3×Flag-MCS-GFP (QZ35395, QIAGEN) was replaced by DreAM though NotI and SpeI sites to produce the LV3-SFFV-DreAM-GFP plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Genetics 2021Quote: ... S2 cells were seeded at 1 × 106 cells/ml in a 6-well plate and transfected using Effectene (Qiagen, Germantown, MD). For mobility shift assay (Figure 4) ...
-
bioRxiv - Immunology 2023Quote: DNA was extracted from 1×10^6 CD4 Th cells/ replicate using the Qiagen DNA mini kit according to manufacturer’s instructions (Qiagen Hilden, Germany). DNA was extracted from 10ng of mouse brain tissue as previously described13 using NEB Monarch High molecular weight DNA extraction kit according to manufacturer’s instructions (NEB Cat #T3050).
-
bioRxiv - Neuroscience 2024Quote: ... S2 cells were seeded at 1 × 106 cells/ml in a 6-well plate and transfected using Effectene (Qiagen, Germantown, MD). For coimmunoprecipitation (coIP ...
-
bioRxiv - Plant Biology 2020Quote: ... a 2 ml subsample of the coarse powder was ground to a fine powder using a Qiagen TissueLyser (Qiagen, Germantown, MD). Finely powdered leaf tissue was then sent to Midwest Laboratories (Omaha ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant containing solubilized protein was filtered using a 0.22 μM nylon membrane filter and incubated with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germantown, MD) at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from infected or mock-treated Caco-2 cells using the Qiagen RNAeasy Plus Extraction Kit (Qiagen, Hilden, Germany). For quantifying the SARS-CoV-2 genome abundance in mock and infected samples ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 viruses were purified from the clinical samples by using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The preparations were analyzed by real-time RT–PCR testing for the determination of viral titers of SARS-CoV-2 by standard curve analysis ...
-
bioRxiv - Genomics 2019Quote: ... 200 μl lysis buffer were used per organoid for homogenization at 12,000 x g for 2 min in a QIAshredder Column (Qiagen, Hilden, Germany) after lysis and prior to addition of 70% ethanol ...
-
bioRxiv - Molecular Biology 2020Quote: ... mantle (Ma) and gonad (Go) tissues were collected and individually transferred to 2-mL tubes containing RNA later (QIAGEN, Maryland, USA) separately ...
-
bioRxiv - Plant Biology 2019Quote: ... 50,000 protoplasts in a volume of 100 μL were transformed with 20 μg of each plasmid (2 μg/μL) purified using the Plasmid Maxi kit (Qiagen, Germany). One batch of protoplasts was treated with an equivalent amount of water and used as the negative (untransformed ...
-
bioRxiv - Microbiology 2019Quote: We carried out RNA extraction on a litter aliquot of 0.2 g for shrub and 0.5 g for grass using RNeasy PowerSoil Total RNA Kit following manufacturer instructions (Qiagen, Hilden, Germany). Due to a high amount of organic compounds co-extracted from shrub litter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We extracted RNA from a total of 348 individuals across two early developmental stages (2 days post fertilization (dpf) and 8 dpf) using RNeasy Mini Kits (Qiagen, Inc.). For 2 dpf libraries ...
-
bioRxiv - Microbiology 2020Quote: ... Each 10 μL uPCR reaction contained 2 μL of DNA template with 1x QuantiTect Multiplex PCR No ROX mastermix (Qiagen™), 0.4 μM each primer ...
-
bioRxiv - Microbiology 2021Quote: A total of 2 x 105 Vero E6 or HEK293ACE-2 cells were seeded 24 hours before transfection with one of the following siRNAs pools (Qiagen SMARTpool): siSTT3A (#GS3703) ...
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted using enzymatic lysis and mechanical disruption of the cells and purified with the RNeasy mini kit (Protocol 2, Qiagen, USA). The RNA standard (25ng ...
-
bioRxiv - Cancer Biology 2021Quote: ... or CRTC3 or control sgRNA (Supplementary Table 2) were transfected into 293FT cells together with packaging plasmids pMD2.G and pSPAX2 using Effectene transfection reagent (Qiagen #301425). The viral supernatants were collected at 48 ...