Labshake search
Citations for Qiagen :
1051 - 1100 of 6183 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Cell Biology 2023Quote: ... and DNase treatment was performed using RNase-free DNase Set (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... DNA digestion was performed using the RNase-Free DNase set (Qiagen). Total RNA was then subjected to ribosomal-RNA depleted RNA sequencing (RNA-Seq ...
-
bioRxiv - Plant Biology 2023Quote: ... Residual DNA was removed using the RNase-free DNase Set (Qiagen). Concentration of RNA extracts was determined using a spectrophotometer (Implen ...
-
bioRxiv - Plant Biology 2023Quote: ... Residual DNA was removed using the RNase-free DNase Set (Qiagen). Concentration of RNA extracts was determined using a spectrophotometer (Implen ...
-
bioRxiv - Molecular Biology 2023Quote: ... with on-column DNase digestion (RNase-Free DNase Set, QIAGEN, 79254) to remove DNA ...
-
bioRxiv - Genomics 2023Quote: ... each set of DEGs were loaded in Ingenuity Pathway Analysis (Qiagen) and examined for shared dysregulation of pathways in the two knockout lines relative to the parental UL3 cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... additional DNase digestion was performed using RNase-Free DNase Set (Qiagen) to completely remove genomic DNA.
-
bioRxiv - Developmental Biology 2023Quote: ... Contaminating genomic DNA was removed by RNase-Free DNase Set (QIAGEN). RNA concentrations were measured on a spectrophotometer (DS-11+ ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... On-column DNA digestion with the RNase-free DNase set (Qiagen), followed by treatment with Ambion TURBO DNase (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... RNA samples were then treated with RNase-free DNase set (Qiagen) to remove gDNA contamination ...
-
bioRxiv - Pathology 2024Quote: ... including on-column DNA digestion (RNase-Free DNase Set, 79254, QIAGEN). RNA from human liver tissue and human cirrhotic PCLS was isolated using Tri Reagent (T9424 ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... The CLC gene set enrichment test (version 1.2, Qiagen, Venlo, Netherlands) was done with default parameters and based on the GO term ’biological process’ (H ...
-
bioRxiv - Plant Biology 2023Quote: ... DNAse treatment was performed using an RNase-Free DNase set (QIAGEN) to remove any DNA contamination ...
-
bioRxiv - Plant Biology 2024Quote: ... then a DNAse treatment with an RNase-Free DNase Set (QIAGEN) and a purification step using lithium chloride precipitation were performed ...
-
bioRxiv - Developmental Biology 2024Quote: ... with on- column DNA digestion (RNase-Free DNase set [Qiagen, Germany]) as per the manufacturers protocol and eluted in 50μL ultra-pure distilled water (Invitrogen ...
-
bioRxiv - Systems Biology 2024Quote: ... and genomic DNA was removed using RNAse-Free DNase Set (Qiagen). Two replicates of each condition were sent to Novogene Corporation Inc (Sacramaneto ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR mix contained 0.16 µM of each of the fluorescent universal primer and of the reverse specified primer and 0.04 µM of the 5’ tail forward primer in a final 15 µl reaction volume (2x QIAGEN Multiplex PCR Master Mix with 3 mM Mg2+ ...
-
bioRxiv - Developmental Biology 2021Quote: 5ng/sample RNA isolated from sperm was reverse transcribed (RT) using the miCURY LNA RT kit (Qiagen #339340). Quantitative RT-PCR (qRT-PCR ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were transfected at 60-80% confluence with 5 nM/1nM (MIN6, EndoCβ-H1, respectively) control or miR-125b mimics (Qiagen) or 50 nM of a mixture of four ONTARGETplus siRNAs against mouse Smad2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... after adding 1.0 x 10^8 copies/μL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... SLE mice were retro-orbitally injected with 10 mg/kg of LNA-miR-22-3p (LNA-22) or scrambled control (LNA-Scr) (miRCURY LNA Inhibitor probe in-vivo, Qiagen) every 2 weeks beginning at 10-12 weeks of age ...
-
bioRxiv - Neuroscience 2020Quote: ... The total RNA including the miRNA fraction was isolated using a miR-Neasy Mini kit (Qiagen Benelux, Venlo, the Netherlands) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: For the functional validation of the miR-124/Zfp36l1 interaction a custom made miRCURY locked nucleic acid (LNA) miRNA Power Target Site Blocker (TSB) (Qiagen) was used with the following sequence ...
-
bioRxiv - Cancer Biology 2022Quote: c-miR isolations from blood serum were carried out using affinity column-based miRNeasy Serum/Plasma Advanced Kit (217204, Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was generated from CSF isolated RNA and a control RNA sample spiked with miR-39 (1 × 108 copies/ul) using the miScript HiSpec kit (Qiagen); dilutions were created from the control cDNA sample spiked with miR-39 (1 ×106-1×103 copies ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were co-transfected at DIV 19 with 10nM of a miR-499-5p or control pLNA inhibitor (miRCURY LNA miRNA-499-5p Power Inhibitor: miR-499-5p or Neg Control A, QIAGEN). After 72h of expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells incubated for 24 hours in a 37 °C incubator and transfected with hsa-miR-24-3p miRCURY LNA miRNA Power Inhibitor (Qiagen, Germantown ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Genomics 2020Quote: ... We used 0.5 ng of total RNA per tissue sample supplied with Cel-mir-39 spike-in (Qiagen, cat# 339390) to perform the reactions in a final volume of 20uL.
-
bioRxiv - Physiology 2022Quote: ... Total RNA was isolated from 200 μL mouse serum following a standardized protocol (PMID: 24357537) using the miRNeasy Serum Plasma kit with ce-miR-39 spike-in (QIAGEN), QIAcube (QIAGEN ...
-
bioRxiv - Neuroscience 2022Quote: ... Specimens were incubated for 24 hours at room temperature in the presence of either an ASO antimiR targeting hsa-miR-134-5p (‘Ant-134’; Qiagen, Manchester ...
-
bioRxiv - Genomics 2022Quote: ... were used according to the manufacturer’s manual: the miRNeasy Serum/Plasma Kit (abbreviated to MIR in this study; Qiagen, 217184), miRNeasy Serum/Plasma Advanced Kit (MIRA ...
-
bioRxiv - Molecular Biology 2023Quote: ... or to mature primate-specific miR-608 (AM608, 15-mer, as a control with no predicted complementary sequences in mice) (LNA, Exiqon, Qiagen). DIO mice were injected intravenously with 3.3 mg/kg oligonucleotide for three consecutive days and were sacrificed 0 ...
-
bioRxiv - Immunology 2024Quote: Total RNA from epididymis white adipose tissue of wide type control mice (n=3) and miR-802 KI mice (n=3) was isolated using the RNeasy mini kit (Qiagen) following the protocol ...
-
bioRxiv - Immunology 2021Quote: ... 0.25μL of 2X QuantiFast RT Mix (QIAGEN), and PCR-grade water (fill to 20 μL) ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified by miScript RT Kit (Qiagen). With the resulting cDNA libraries ...
-
bioRxiv - Microbiology 2022Quote: One-Step Probe RT-qPCR kits (Qiagen) and CFX96 system/software (BioRad ...
-
bioRxiv - Immunology 2021Quote: One-Step Probe RT-qPCR kits (Qiagen) and CFX96 system/software (BioRad ...
-
bioRxiv - Cancer Biology 2022Quote: ... miScript II RT Kit (Qiagen, Hilden, Germany) was used to convert the RNA to cDNA via a thermocycler (Eppendorf ...
-
bioRxiv - Molecular Biology 2024Quote: ... The miRCURY LNA RT Kit (Qiagen, UK) was used to synthesise cDNA using 50-100ng of RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... or miRCURY LNA RT Kit (339340; Qiagen). PCR was performed using miScript II (218073 ...
-
bioRxiv - Genomics 2024Quote: ... The miRCURY LNA RT Ki (Qiagen, UK) was used to synthesise cDNA and miRCURY LNA RT Kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... RT² SYBR Green qPCR Mastermix (Qiagen®) and samples cDNA and the quantitative RT-PCR was carried out with a LightCycler 480 (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... or miRCURY LNA RT Kit (Qiagen Sciences) for analysis of mRNA or miRNA respectively ...
-
bioRxiv - Microbiology 2021Quote: ... The himar1 enriched samples were diluted 1:50 and amplified by using a P5 indexing primer (AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC, [i5] barcode sequence) and P7 primer HotStarTaq Master Mix Kit (Qiagen) to add unique barcodes and the necessary P5 and P7 flow cell adaptor sites for Illumina sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... MDA controls were performed employing a random-primers-based MDA (RP-MDA) kit as random-primer-based method: Repli-g Mini Kit from QIAGEN; and a TruePrime-based-MDA (PrimPol-MDA ...
-
bioRxiv - Microbiology 2024Quote: ... transposon junctions were amplified by using a transposon-specific primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and a primer P7 (CAAGCAGAAGACGGCATACGAGAT) using the HotStarTaq master mix kit (Qiagen). The himar1-enriched samples were diluted in a ratio of 1:50 ...
-
bioRxiv - Microbiology 2019Quote: ... and Quantitect murine TNF-R1 primer assay (Qiagen) or hypoxanthine– guanine phosphoribosyltransferase (HPRT ...