Labshake search
Citations for Qiagen :
1051 - 1100 of 1682 citations for Adenovirus Type 5 Hexon Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... with 0.2% (m/v) arabinose and the recombinant protein was affinity purified using Ni-NTA agarose (Qiagen). For GST-CPK3 ...
-
bioRxiv - Microbiology 2023Quote: Protein complexes were produced from the relevant pQE70 plasmid (see Table S2) in strain M15 pREP4 (Qiagen) as follows ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins transferred to a nitrocellulose membrane were probed with a monoclonal anti-His6 antibody (Qiagen, Germantown, Maryland). Detection of proteins via Western blotting was performed by fluorescence detection using IR-Dye®-labeled fluorescent secondary antibodies and imaged using the Odyssey CLx Imager (LICOR Biosciences ...
-
bioRxiv - Microbiology 2023Quote: ... The purified recombinant proteins were analyzed by western-blot with anti-His antibody (1:2000 dilution) (Qiagen) followed by HRP-labeled anti-mouse IgG (1:50000 dilution ...
-
bioRxiv - Immunology 2023Quote: ... Protein exaction from the deparaffinised sample was carried out using the Qiagen Qproteome kit (Qiagen, Hilden, Germany) as per the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... The His-ZmTPL2N-His recombinant protein was purified using Pierce Ni-NTA resin (QIAGEN, Cat. No. 30210) according to the product protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... CBS proteins with a TEV cleavable N-terminal His-tag were purified using Ni-NTA agarose (Qiagen) resin and were treated to gel filtration using a Superose 6 Increase 16/600 column or Superdex 200 Hiload 16/600 column (Cytiva ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from all the cell lines using AllPrep DNA/RNA/Protein Mini Kit (Qiagen). The total RNA was then treated with Turbo DNA-free kit (Invitrogen ...
-
bioRxiv - Biophysics 2022Quote: Melting curves of proteins were measured using the Rotor-Gene Q real-time PCR cycler (Qiagen, Germany). 25 μl samples with a protein concentration of approximately 0.5 mg/ml in a buffer containing 100 mM NaCl ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA for each Klebsiella strain was extracted using the AllPrep Bacterial DNA/RNA/Protein kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... supernatants were harvested and His-tagged tIgM-Fc (tFcµ) protein was purified using Ni-NTA Agarose (Qiagen) and subsequently ...
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from FACS-purified cells using Allprep DNA/RNA/protein mini kits from Qiagen. Sperm cells were lysed using differential extraction ...
-
bioRxiv - Biophysics 2023Quote: ... 0.2 mM TCEP) the expressed protein was extracted from the supernatant using NiNTA resin (QIAGEN, Germantown, MD). The resulting eluate from the NiNTA resin using lysis buffer supplemented with 250 mM Imidazole pH 7.4 ...
-
bioRxiv - Microbiology 2023Quote: ... the soluble fraction was used for the purification of heterologous proteins using Ni-NTA agarose resin (QIAGEN), previously equilibrated with equilibration buffer (200 mM NaCl ...
-
bioRxiv - Biochemistry 2024Quote: ... The identified proteins were then subjected to annotate the biological functions by Ingenuity Pathway Analysis (IPA, Qiagen). Molecules from the dataset that met the cutoff of the Ingenuity Knowledge Base were considered for the analysis ...
-
bioRxiv - Microbiology 2024Quote: ... His-tagged proteins were detected with a mouse anti-His HRP-conjugated antibody (1:3000) from Qiagen. MBP fusion proteins were detected with a rabbit anti-MBP from NEB company 1:1000 followed by an incubation with a goat anti-rabbit HRP-conjugated (1:3000) ...
-
bioRxiv - Microbiology 2022Quote: ... LF/LF = 5 mice from two cages over two experiments) using the DNeasy PowerSoil Kit (Qiagen, Germantown, MD). Modifications to the standard protocol included a 10-minute incubation at 65°C immediately following the addition of the lysis buffer and the use of a bead mill homogenizer at 4.5 m/s for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA-Seq libraries were prepared from 5 ng total RNA using the NEB Next RNA Ultra Kit (QIAGEN) with poly(A ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Microbiology 2021Quote: ... 20 mM imidazole was added to the supernatant and incubated with 5 mL of Ni-NTA resin (Qiagen) with a stirring magnet at 4°C for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... and 5 cells per well were sorted into a 96-well plate containing TCL buffer (Qiagen, cat. 1031576) with 1 % beta- Mercaptethanol and snap frozen on dry ice ...
-
bioRxiv - Biophysics 2022Quote: ... The suspension was spun down at 16,000 r.c.f at 4 °C for 30 min and the supernatant was applied 5 ml Ni-NTA resin (Qiagen)/ L culture medium ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Neuroscience 2019Quote: ... we added 0.6 μL Proteinase K stop solution to each tube (5 mg/mL Proteinase K solution (Qiagen), 50 mM EDTA ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Developmental Biology 2019Quote: Total RNA from approximately 25 EBs at day 5 of differentiation was isolated using RNeasy Mini kit (Qiagen) and quantified by NanoDrop (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... total DNA from 5 × 105 J-Lat cells was purified using Qiagen blood mini kit (Qiagen, Hilden, Germany) and quantitated spectrophotometrically ...
-
bioRxiv - Microbiology 2021Quote: ... prior to the addition of proteinase K and 5 μl of 100 mg ml−1 RNase A (Qiagen). The DNA concentration was determined using a Qubit fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... Red blood cells were removed by treating the cells with 5 ml Red Blood Cell Lysis buffer (Qiagen) for 4 min ...
-
Alzheimer’s patient brain myeloid cells exhibit enhanced aging and unique transcriptional activationbioRxiv - Neuroscience 2019Quote: ... FACS-isolated cell populations were spun at 5,000 rcf for 5 minutes and resuspended in 0.35 ml Buffer RLT from Qiagen RNeasy Micro kit ...
-
bioRxiv - Cancer Biology 2019Quote: ... The reverse transcription step exactly followed SMART-seq2 protocol with 5’-biotinylated TSO (Qiagen, primers see Table S9). The first round of 24-cycle PCR started with 10µl reverse transcription product ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA for expression analyses was extracted from 5 day-old protonemata using a RNeasy Plant Mini Kit (Qiagen). Genomic DNA removal and cDNA synthesis were performed with a Quantitect Reverse Transcription kit (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from 5×106 cells per sample using the AllPrep DNA/RNA/miRNA Universal Kit (QIAGEN) according to manufacturer’s recommendations with additional DNase I treatment for RNA extraction ...
-
bioRxiv - Developmental Biology 2022Quote: ... Complementary DNA of microRNAs was synthesized from 5 μg total RNA using microRNA-specific primers (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Genomic DNA was eluted from the column using 5 mL of prewarmed (50°C) QF Buffer (Qiagen, Germany). DNA was precipitated by adding 0.7 volumes of isopropanol ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from the Sterivex filters (i.e., 0.22–5 μm size fraction) using an AllPrep DNA/RNA Mini Kit (80204; Qiagen) with a modified protocol ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from 5-10 snap-frozen larvae with the RNeasy Mini kit (Qiagen cat no. 74104) and reverse-transcribed using QuantiTect Reverse Transcription kit (Qiagen cat no 205311 ...
-
bioRxiv - Immunology 2022Quote: Total RNA from ~ 5 × 105 neutrophils (CD45+Lin-CD11b+Ly6G+) was isolated with the RNeasy micro kit (Qiagen) and RNA quality was checked with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Glycerol was added to the remaining culture to a final concentration of 15% (v/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). The remaining 95 mL of culture was combined with 40.7 mL 50% glycerol (v/v) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR amplification was carried out in 5 µl reactions using the QIAGEN Multiplex PCR Kit (QIAGEN, Germany). Each sample reaction contained 10–20 ng of genomic template DNA ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... A 5 ml aliquot of culture was removed and added to 10 ml of RNAprotect Bacteria Reagent (Qiagen) and mixed by vortexing ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... Edmund Bühler) by bead beating twice for 5 min at 30 Hz in a Tissue Lyzer II (QIAGEN). Lysates were then incubated for 30 min at 37 °C with shaking ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA from 5-day-old whole plants was extracted using the RNeasy Plant Mini Kit (Qiagen, 74904). For RNA-seq ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 5-10 g of soil per sample with the DNeasy PowerMax Soil Kit (Qiagen) and used for short read and long read sequencing ...