Labshake search
Citations for Qiagen :
901 - 950 of 6183 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The U6 snRNA primer from Qiagen was used for normalization ...
-
bioRxiv - Cell Biology 2023Quote: ... with validated gene-specific primers (Qiagen) on the QuantStudio™ 5 System ...
-
bioRxiv - Molecular Biology 2023Quote: ... we purchased commercial primers from Qiagen. Primers for mouse Sprr1a (GeneCopoeia ...
-
bioRxiv - Immunology 2023Quote: ... Pre-synthesized QuantiTect primers from Qiagen were used for il12b ...
-
bioRxiv - Genetics 2024Quote: ... Dm_miR-8_1 miScript Primer assay (QIAGEN), and Dm_miR-14_1 miScript Primer assay (QIAGEN ...
-
bioRxiv - Neuroscience 2019Quote: ... qPCR was performed using a custom LNA probe for miR-1002 using the miRCury SYBR green reagent (Qiagen).
-
bioRxiv - Cancer Biology 2019Quote: ... cells were transfected with 12.5 or 6.25nM locked nucleic acid (LNA) miRNA inhibitors (miR-194 LNA inhibitor or negative control inhibitor; Qiagen).
-
bioRxiv - Developmental Biology 2022Quote: ... miR-1 miRCURY LNA miRNA Power Inhibitor and miRCURY LNA miRNA mimic were obtained from Qiagen (Germantown, MD). miR-1 inhibitor (Hsa-miR-1-3p ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from a 10 mL culture using the QIAGEN® Genomic DNA Buffer Set and Genomic-tips™ 100/G set (midi-prep) (QIAGEN, Hilden, Germany). This procedure adhered to the Sample Preparation and Lysis Protocol for Bacteria as outlined in the QIAGEN® Genomic DNA Handbook ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of the template was used in a 25 μL reaction using the QuantiFast Probe RT-PCR Kit (Qiagen, Inc., Valencia, CA) with 0.4 μM of each primer and 0.2 μM probe ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (200 ng) was reverse-transcribed in cDNA and amplified by using QuantiNova SYBR Green RT-PCR kit (QIAGEN®, Hilden, Germany). Viral genomes were extracted from the supernatants at different time points post-infection using Takara MiniBEST Viral RNA/DNA (Takara Bio ...
-
bioRxiv - Cancer Biology 2024Quote: ... To profile the expression of genes related to p53-mediated signal transduction based on the RT² Profiler™ PCR Array Human p53 Signaling Pathway (#330231, PAHS-027ZC, Qiagen, Hilden, Germany), reverse transcription and qPCR were performed using the RT2 First Strand Kit (#330401 ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-PCR reactions for each primer set were performed on RNA (50-75 ng/ul) from at least two biological replicates of the mutant allele and control (QIAGEN OneStep RT-PCR Kit, QIAGEN Inc., Cat # 210212). The bounds of where transcriptional termination and initiation occurs within Mu for each mutant allele was determined by presence of amplification from gDNA and absence of amplification from cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... 200 ng of total RNA was reverse-transcribed in cDNA and then amplified using QuantiNova SYBR Green RT-PCR kit (QIAGEN®, Hilden, Germany). Primers ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon junctions were amplified by using a transposon specific primer Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and P7 (CAAGCAGAAGACGGCATACGAGAT) primers with HotStarTaq Master Mix Kit (Qiagen). The following PCR condition was used ...
-
bioRxiv - Microbiology 2019Quote: ... Transposon junctions were amplified by using a transposon specific primer Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and p7 primers (CAAGCAGAAGACGGCATACGAG) with HotStarTaq Master Mix Kit (Qiagen) with the following PCR condition (94 °C for 3 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μL of cDNA was added to 1 μL of pre-purchased primers (QuantiTect primers (Qiagen, Germany)) and qPCR was carried using the StepOnePlus machine (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... All the primers (forward, reverse and sequencing primers) were designed with the PyroMark Assay Design software (Version 2.0.1.15, Qiagen) using the assay type "Methylation Analysis" (CpG ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was treated with DNase (DNase-Free DNase Set, Qiagen) and repurified using the miRNeasy micro plus Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... Residual DNA was eliminated using RNAse-Free DNase Set (Qiagen). Sorted nuclei were pelleted before proceeding with downstream RNA isolation ...
-
bioRxiv - Developmental Biology 2021Quote: ... and DNAse-treated with the RNAse-free DNAse Set (QIAGEN). Samples were reverse transcribed using the TaqMan Reverse Transcription Kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and DNase-treated with the RNase-Free DNase Set (Qiagen). RNA was quantified using Qubit Fluorometric Quantitation (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was treated with an RNase-free DNase set (Qiagen). The purified RNA was quantified spectrophotometrically (NanoDrop ND-1000).
-
bioRxiv - Molecular Biology 2021Quote: ... with on-column DNA digestion (RNase-free DNase Set, Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2019Quote: 2.3.1 The Mini-Genomic DNA Buffer Set (Qiagen, Cat #: 19060) can be used to isolate the genomic DNAs from animal tissue samples.
-
bioRxiv - Neuroscience 2019Quote: ... and genomic DNA contamination quality control parameters set by Qiagen’s methods (RT2 Profiler PCR Array Data Analysis v3.5) ...
-
bioRxiv - Plant Biology 2020Quote: ... A DNase Digestion with the RNase-free DNase set (QIAGEN) was included in the procedure ...
-
bioRxiv - Cancer Biology 2021Quote: ... and concentration using the RNase-Free DNase Set (Qiagen 79254) and QIAquick PCR Purification Kit (Qiagen 28104) ...
-
bioRxiv - Cell Biology 2021Quote: ... set on HIGH and purified with Qiagen MinElute kit (Qiagen). After fragmentation ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by DNAse treatment (RNase-free DNase set; Qiagen, Germany) and reverse transcription reaction (Omniscript RT kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was treated with the RNase-free DNase Set (Qiagen) and quantified using the Qubit dsRNA High Sensitivity kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and subsequently treated with RNase-Free DNase Set (QIAGEN #79254).
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA was treated with RNase-Free DNase Set (Qiagen), following the kit’s instruction ...
-
bioRxiv - Plant Biology 2020Quote: ... DNA was removed using the RNase-Free DNase Set (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was treated with the RNase-Free DNase Set (Qiagen) with the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2020Quote: ... DNase treatment was performed using a DNase set (Qiagen, 79254). cDNA was then synthesized using 1 μg input RNA by BIO-RAD iScript gDNA Clear cDNA Synthesis Kit (1725035) ...
-
bioRxiv - Genomics 2022Quote: ... with the Genomic DNA Buffer Set (Qiagen; Cat. no. 19060) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA was removed using the RNase-Free DNase Set (QIAGEN). RNA was quantified with Nanodrop 2000 ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs were purchased as a set of four from Qiagen for myosin IIA (GS17886) ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA was removed using RNAse-free DNAse set (Qiagen, 79254) using the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was treated with DNase (DNase-Free DNase Set, Qiagen) and repurified using the RNeasy micro plus Kit (Qiagen) ...
-
bioRxiv - Plant Biology 2019Quote: ... and was treated with DNase (RNase-Free DNase Set, Qiagen). Methods for RT-qPCR and transcriptome analyses can be found in Methods S6.
-
bioRxiv - Developmental Biology 2019Quote: ... Isolated RNA was DNAse-treated with the DNase set (Qiagen), column purified using RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo) ...
-
bioRxiv - Physiology 2021Quote: ... and Genomic DNA Buffer Set (all from Qiagen, Hilden, Germany), essentially following the protocol described in the Qiagen Genomic DNA Handbook ...
-
bioRxiv - Pathology 2019Quote: ... DNase treatment was performed using RNase-Free DNase Set (Qiagen) and then purified using RNeasy® MinElute® Cleanup Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... RNA samples were treated with RNase-Free DNase Set (Qiagen) to remove any DNA ...
-
bioRxiv - Plant Biology 2019Quote: ... A DNase digestion with the RNase-free DNase set (QIAGEN) was performed ...
-
bioRxiv - Plant Biology 2021Quote: ... an on-column DNAse digest (RNase-Free DNase Set, Qiagen), and eluting 2x with 50 μL RNAse free water ...
-
bioRxiv - Cancer Biology 2020Quote: ... including DNase I digestion step (RNase-Free DNase set, Qiagen). 1 μg of RNA was reverse transcribed (iScript cDNA Synthesis Kit (BioRad) ...