Labshake search
Citations for Qiagen :
851 - 900 of 6183 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... in combination with the RNase-Free DNase Set (QIAGEN). Integrity of RNA samples was evaluated using the RNA 6000 Nano Kit (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with the RNase-Free DNase Set (QIAGEN). The isolated RNA was loaded on a 15% TBE Urea size selection gel and after staining with SYBR Gold (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... in conjunction with the RNase-Free DNase Set (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... and treated with the RNase-Free DNase Set (Qiagen). 1 µg total RNA was reverse transcribed with oligo dT using Sensifast cDNA Synthesis kit (Meridian Bioscience ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with the RNase-Free DNase Set (QIAGEN) according to the manufactureŕs instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... with DNase digest using RNase-free DNase set (QIAGEN).
-
bioRxiv - Plant Biology 2023Quote: ... including the treatment with RNase-Free DNase Set (QIAGEN).
-
bioRxiv - Neuroscience 2020Quote: ... and miR-9/9*-124 + shPTBP2 using TRIzol Reagent in combination with RNeasy mini kit (Qiagen, 74104). RNA quality (RIN > 9.6 ...
-
bioRxiv - Molecular Biology 2022Quote: Myotubes were transfected using either 5nM hsa-miR-148a-3p miRCURY LNA miRNA Mimic (QIAGEN, YM00472598-ADB) or negative control miRCURY LNA miRNA Mimic (QIAGEN ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 nM of a miR-96-5p inhibitor or 100nM of a scrambled inhibitor (control) (Qiagen, UK).
-
bioRxiv - Cancer Biology 2022Quote: ... The following oligos at the indicated concentration were used: 5nM of miR-455-5p mimic (MSY0003150, Qiagen) or recommended All Stars negative control siRNA (cat ...
-
bioRxiv - Neuroscience 2023Quote: ... were used to analyse the levels of PrPC in vitro after has-miR-519a-3p Mimic (Qiagen) transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1× QuantiNova RT Mix (Qiagen), 1× QuantiNova SYBR Green RT-PCR Master mix ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized by Qiagen Omniscript RT Kit (#205111, Qiagen). RT-qPCR was performed using QuantiTect SYBR® Green PCR Kit (#204145 ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was synthesized by Qiagen Omniscript RT Kit (#205111, Qiagen). RT-qPCR was performed by using QuantiTect SYBR® Green PCR Kit (#204145 ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was synthesized by Qiagen Omniscript RT Kit (205111, Qiagen). The relative mRNA level of indicated genes was normalized to that of the internal control Hsp90 and calculated by the equation 2^(Ct(cycle threshold ...
-
bioRxiv - Bioengineering 2019Quote: ... Sensiscript RT Kit (QIAGEN, Germany) was used for cDNA synthesis with 50 ng per reaction according to the manufacturers’ instructions ...
-
bioRxiv - Genetics 2020Quote: ... with RT² SYBR Green (Qiagen), POWER SYBR (Thermo Fisher) ...
-
bioRxiv - Genetics 2022Quote: ... miScript II RT Kit (Qiagen) was used to synthesize cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... the Omniscript RT kit (Qiagen) using random hexamers (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... the detection of N-gene of SARS-CoV-2 was performed by using the 2019-nCoV-2 RUO kit (Integrated DNA Technologies, Inc., Coralville, Iowa, USA) and One-Step RT-PCR Kit (QIAGEN® GmbH) on a Rotor-Gene Q real-time PCR cycler (QIAGEN® GmbH) ...
-
bioRxiv - Microbiology 2022Quote: ... Correct introduction of the NS1 mutations was verified via cDNA synthesis of viral RNA using the One-Step RT-PCR kit (Qiagen, Hilden, Germany), amplification and sequencing using NS-specific primers ...
-
bioRxiv - Immunology 2020Quote: RNA from B1a B cells was reverse transcribed and amplified using a Qiagen OneStep RT-PCR kit (Qiagen Inc., Valencia, CA, USA) and iRepertoire® mouse BCR heavy chain (MBHI ...
-
bioRxiv - Microbiology 2020Quote: ... an aliquot of the extracted RNA solution was added to the reaction mixture for the QuantiTect probe RT-PCR kit (Qiagen, Hilden, Germany), which contained 2x QuantiTect probe RT-PCR master mix ...
-
bioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instruction and the resulting cDNA was used for reverse transcription-polymerase chain reaction (RT-PCR) using HotStarTaq Plus Master Mix Kit (Qiagen, Germantown, MD). The PCR conditions used were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT2 qPCR Primer assays for GAPDH and primers for target genes were respectively purchased from Qiagen and IDT ...
-
bioRxiv - Developmental Biology 2019Quote: ... Primers sequences are shown in Extended data table 2 and predesigned quantitech primer assays (Qiagen, 249900) were used for other genes including Gal (QT00109970) ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of 20 mM of each primer (KAN-2 FP1 or KAN-2 RP1 complementary to the Tn5 sequence with the bubble primer 224) and 10 μL of the 10X Qiagen Multiplex PCR Master Mix Kit (Qiagen, Valencia, CA, USA) in a final volume of 100 μL ...
-
bioRxiv - Plant Biology 2022Quote: ... All qPCR reactions were performed with primer concentrations at a final concentration of 250 nM in a Rotor-Gene Q real-time PCR cycler (Qiagen, Q-Rex v1.0), using the Rotor-Gene SYBR Green PCR Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Real-time quantitative PCR was performed on 40 pg cDNA using specific primers (Supplementary Table 1) and miRCURY® LNA® miRNA SYBR® Green PCR (Qiagen). Values were normalized to miRNA quantity and expressed as relative expression to control WS using formulae 2−ΔCT.
-
bioRxiv - Genetics 2023Quote: ... 4 μL PCR mastermix (made up of 0.75 μl at a concentration of 0.2 μM of each primer, 80 μl ultrapure water, and 250 μl QIAGEN Multiplex PCR mix; QIAGEN Inc. Cat. No. 20614). PCR conditions were as follows ...
-
bioRxiv - Microbiology 2024Quote: ... were PCR amplified (see Table S4 for primer sequences) from 3D7 or IT4 gDNA (Monarch gDNA Purification Kit, NEB or QIAGEN DNA extraction kit) and cloned into pSLI (Birnbaum et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-qPCR reactions were run using a QuantiTect SYBR Green RT-qPCR kit (Qiagen, 204243) on a Qiagen Rotorgene Q ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-qPCR reactions were run using the QuantiTect SYBR Green RT-qPCR kit (Qiagen, 204243) on a Qiagen Rotor-Gene Q ...
-
bioRxiv - Cancer Biology 2021Quote: ... using predesigned Quanititect Primer assays (Qiagen) to the following murine genes ...
-
bioRxiv - Molecular Biology 2021Quote: ... and QuantiTect primer assays (Qiagen, 249900) that were used for lncRNA and mRNA expression analysis are listed in Additional file 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The following miScript Primer Assays (Qiagen) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... The following qPCR primers from Qiagen were used ...
-
bioRxiv - Systems Biology 2020Quote: ... Primers used were ordered from Qiagen, including GATA4 (QT00031997) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The RT2 qPCR primer assays (Qiagen) or qPCR primers (IDT ...
-
bioRxiv - Cancer Biology 2019Quote: ... We purchased all primers from Qiagen, collected raw data and analyzed levels of relative mRNA expression with 2-ΔΔCt method ...
-
bioRxiv - Cancer Biology 2022Quote: ... The primers were: Hs_AREG (Qiagen; #QT00030772); Hs_PIDD1 (Qiagen ...
-
bioRxiv - Physiology 2021Quote: ... All primers were purchased from Qiagen.
-
bioRxiv - Immunology 2021Quote: ... and random hexamer primers (Qiagen, 79236) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... All primers were purchased from Qiagen.
-
bioRxiv - Cell Biology 2021Quote: ... All primers were purchased from Qiagen website ...
-
bioRxiv - Cell Biology 2020Quote: ... Predesigned QuantiTect® Primer Assays (Qiagen) were used for all genes ...
-
bioRxiv - Physiology 2022Quote: ... with validated gene-specific primers (Qiagen) on the QuantStudio™ 5 System ...
-
bioRxiv - Molecular Biology 2024Quote: ... Validated primers were obtained from Qiagen, UK for the miRNAs ...
-
bioRxiv - Developmental Biology 2023Quote: ... ilp8 primers used from Qiagen (QT00510552), dmyc forward primer (AACGATATGGTGGACGATGG) ...