Labshake search
Citations for TianGen Biotech :
351 - 400 of 620 citations for hsa mir 185 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Protein concentration was measured using Bradford protein assay kit (Tiangen Biotech, Beijing Co., LTD, CN). The purity of the PM was determined by standard marker assays[32] ...
-
bioRxiv - Molecular Biology 2019Quote: ... genomic DNA was isolated using Soil Genome DNA Extraction Kit DP336 (TIANGEN BIOTECH, CO., LTD). A fragment of the mitochondrial cytochrome oxidase I (CO I ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmid site-directed mutagenesis was performed using the Fast Site-Directed Mutagenesis Kit (TIANGEN, Beijing). All the site-directed mutation primers are listed in Table S3 ...
-
bioRxiv - Immunology 2020Quote: ... and collected at 24 h) using the RNAsimple Total RNA Kit (Tiangen Biotech, Beijing, China) as described in the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... Total DNA was extracted using the TIANamp Genomic DNA Kit (TIANGEN BIOTECH [BEIJING] CO, LTD). DNA concentration and purity were measured with the NanoDrop2000 system (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Fresh retinas were subjected to RNA extraction using RNAsimple Total RNA Kit (DP419, TIANGEN, China) per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: The total RNA was extracted using the RNA prep pure plant kit (Tiangen Biotech (Beijing) Co. ...
-
bioRxiv - Plant Biology 2022Quote: ... and cDNA was synthesized by the FastKing cDNA First-Strand Synthesis Kit (TIANGEN, Beijing, China). qRT-PCR was performed using a SYBR Green PCR Master Mix kit on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... The strains were expanded and cultured with a TIANprep Mini Plasmid Kit (DP103, Tiangen, China). The known standard curves were used to quantify the initial amount of the target template of the unknown sample ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was then extracted using the RNAprep Pure Plant Plus Kit (TIANGEN, Cat. #DP441), following the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... Total RNAs were extracted using an RNAprep Pure Plant Kit (Cat. no: 4992237; Tiangen, China). A cDNA library was constructed using the TIANSeq Fast RNA Library Prep Kit (Cat ...
-
bioRxiv - Biochemistry 2023Quote: Total RNA was isolated from samples using the RNAprep Pure Plant Kit (Tiangen, Beijing, China), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Positive plasmid extracted from clones with correct sequence using TIANprep Mini Plasmid Kit II (Tiangen).
-
bioRxiv - Genomics 2023Quote: Total genomic DNA was extracted from leaf samples using the New Plant DNA Kit (TIANGEN). After DNA concentration and integrity were detected ...
-
bioRxiv - Genomics 2023Quote: ... Total RNA was extracted from flower and fruit using RNAprep Pure Plant Plus Kit (TIANGEN), cDNA libraries were constructed and sequenced by Illumina NovaSeq 6000 (Illumina ...
-
bioRxiv - Bioengineering 2023Quote: The recombinant plasmids were extracted using the TIANprep Rapid Mini Plasmid Kit (TIANGEN, Beijing, China). Genomic DNAs of bacteria were extracted using the Wizard Genomic DNA Purification Kit (Promega ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted from plants using RNA Easy Fast Plant Tissue Kit (Tiangen Biotech). First-strand cDNA was synthesized with a PrimeScript™ RT reagent kit with gDNA Eraser (Takara) ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA was isolated using the TIANamp Bacteria DNA Kit (TIANGEN Biotech Co., Ltd., China). LC-MS/MS technique was employed to detect DNA base modifications on the extracted E ...
-
Mutations in HUA2 restore flowering in the Arabidopsis trehalose 6-phosphate synthase1 (tps1) mutantbioRxiv - Plant Biology 2024Quote: Total RNA was extracted from Arabidopsis seedlings using the RNA Isolation Kit (Tiangen, China, DP441) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA was extracted from oocytes or tissues using RNAprep Pure Micro Kit (Tiangen, DP420) or RNA Easy Fast Kit (Tiangen ...
-
bioRxiv - Cancer Biology 2024Quote: ... All DNA sequences were confirmed by sequencing after purification (EndoFree Maxi Plasmid Kit, TIANGEN Biotech). The sequences of these plasmids were listed in Table S1.
-
bioRxiv - Cancer Biology 2024Quote: ... The library plasmids were then extracted with the EndoFree Maxi Plasmid Kit (Tiangen, Cat# 4992194).
-
bioRxiv - Bioengineering 2024Quote: ... The plasmids were extracted from the colonies using the TIANprep Mini Plasmid Kit (Tiangen, DP103).
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA of harvested cultures was extracted using the TIANamp Bacteria DNA kit (Tiangen Biotech). PCR primers VPA0427SNPU (AGCGACGACGCCAGAGAAAG ...
-
High-resolution chromosome-level genome provides molecular insights into adaptive evolution in crabsbioRxiv - Genomics 2024Quote: ... the resulting DNA fragments were purified using the TIAN quick mini purification kit (Tiangen Biotech). After purification ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from the bacterial suspension using a DNA extraction kit (Tiangen, China) and subsequently subjected to PCR using universal 16s rRNA primers [18] ...
-
bioRxiv - Microbiology 2024Quote: ... The bacteria genomic DNA was extracted using the TIANamp Genomic DNA Kit (TIANGEN, Beijing, China) from bacteria ...
-
bioRxiv - Microbiology 2020Quote: The DNA and RNA of virus were extracted by using TIANamp Virus DNA / RNA Kit (TIANGEN) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total DNA was extracted from the tail using a TIANamp Genomic DNA kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... max roots were harvested and total RNA was extracted using an RNAprep Plant plus Kit (Tiangen), and 1st strand cDNA was synthesized using Transcript One-Step gDNA Removal and cDNA Synthesis super Mix Kit (TransGen Biotech.) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Total RNA was isolated from muscle tissues in offspring using RNAprep Pure Tissue Kit (TIANGEN, Beijing). According to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... The lysine to arginine point mutants of MyD88 were generated using the QuikChange mutagenesis kit (Tiangen). All constructs were confirmed by sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: ... The genomic DNA (gDNA) was extracted from above tissues using the TIANamp Genomic DNA Kit (TIANGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and the RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit (TIANGEN Co., Ltd., Beijing, China) was used to extract total RNA.
-
bioRxiv - Genomics 2021Quote: Total RNA was extracted and purified with the RNAprep Pure Plant Kit (Tiangen Biotech, Beijing, China). Poly(A)+ mRNA was enriched with oligo (dT ...
-
bioRxiv - Genomics 2021Quote: Total RNA was extracted and purified with the RNAprep Pure Plant Kit (Tiangen Biotech, Beijing, China) from each sample list in Supplemental Table S2 ...
-
bioRxiv - Bioengineering 2021Quote: ... The total RNA was then extracted using an RNAprep Pure Cell/Bacteria Kit (Tiangen Biotech, China). The extracted total RNA was then treated with DNase I to remove the genomic DNA and used as a template for cDNA synthesis with random primers and SuperScriptTMIII Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... plasmid extraction was performed following the manuals of the TIANprep Mini Plasmid Kit (TIANGEN, DP103-02) or AxyPrep Plasmid Miniprep Kit (AXYGEN ...
-
bioRxiv - Microbiology 2020Quote: ... All the DNA samples were purified through a DNA kit column (DP214-02, Tiangen, Beijing, China) and kept at −20°C until further analysis (6) ...
-
bioRxiv - Microbiology 2021Quote: ... Then the crude RNA was purified by RNA prep Pure Cell/Bacteria Kit (TIANGEN, Product #DP430) and genomic DNA was removed by DNase I (NEB ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA from collected samples was purified with the RNAprep Pure Micro Kit (TIANGEN, Beijing, China) and reversely transcribed into cDNA with a First Strand cDNA Synthesis Kit (Beyotime ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA from an intact gonad was extracted and purified using the RNAprep pure Micro Kit (TIANGEN). The quality of RNA was determined by Nanodrop ...
-
bioRxiv - Microbiology 2022Quote: ... 86 SF samples from patients in RAS4 had bacteria DNA content (≥10ng) (Bacterial DNA Kit, TIANGEN) for bacteria 16S rRNA gene high-throughput sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... and SV40-MES-13 cells was extracted with RNA simple Total RNA Kit (Tiangen, Beijing, China). cDNA was synthesized with TIANScript□RT Kit (Tiangen ...
-
bioRxiv - Plant Biology 2021Quote: ... qPCR reactions were made with a SuperReal PreMix Plus SYBR Green Kit (TIANGEN Biotech, BeiJing, China) following manufacturer’s instructions in a 20 μL volume ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA was extracted from broth cultures using a commercial Bacteria DNA Kit (TIANGEN, Beijing, China), and was then analyzed by electrophoresis on a 1% agarose gel as well as a Qubit 2.0 (Thermo Scientific ...
-
bioRxiv - Immunology 2020Quote: ... and total bacterial DNA was extracted using a bacterial DNA extraction kit (DP302-02, Tiangen, China) as per the manufacturer’s protocols ...
-
bioRxiv - Immunology 2020Quote: ... RNA extraction and cDNA reverse transcription were performed using an RNA extraction kit (DP419, Tiangen, China) and reverse transcription kit (A5000 ...
-
bioRxiv - Microbiology 2019Quote: The genomic DNA of the sixteen strains were extracted using TIANamp Bacteria DNA Kit (TIANGEN, Beijing) following to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... The genome extraction from mouse embryos or pups were using the TIANamp Genomic DNA Kit (TIANGEN), which used for genotyping or bisulphite sequencing.