Labshake search
Citations for Eurogentec :
1 - 50 of 128 citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative RT–PCR was performed using qPCR MasterMix Plus Low ROX (Eurogentec) and TaqMan Gene Expression Assays (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... IS2404 and KR-AB were then tentatively amplified by real-time PCR using RT-PCR reagents (Takyon, Eurogentec, Liège, Belgium) and primers and probes as previously described (8).
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative (q) real time PCR (q-RT PCR) was performed with the MESA Green qPCR MasterMix Plus for SYBR Assay® (Eurogentec) using the Applied Biosystems™ StepOnePlus™ Real-Time PCR System ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative RT-PCR was performed using Takyon No ROX SYBR Mastermix blue dTTP (Kaneka Eurogentec) in reaction volume 20 μl ...
-
bioRxiv - Plant Biology 2020Quote: ... Reverse transcription quantitative PCR (RT-qPCR) was carried out with Takyon No ROX SYBR mastermix (Eurogentec, Belgium) as in Atkinson et al.17 ...
-
bioRxiv - Molecular Biology 2019Quote: ... For RT-qPCR the MESA Blue qPCR MasterMix Plus kit was used (Eurogentec). For each gene MESA Blue was mixed with 100nM forward and reverse primers (refer to table 2.2) ...
-
bioRxiv - Cell Biology 2019Quote: ... mRNA expression was measured by quantitative (Q)-PCR using SYBR Green Mastermix (#RT-SY2X-NRWOU+B, Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR amplification was performed using MESA Green qPCR MasterMix for SYBR assay (Cat. No. RT-SY2X-03+WOUN, Eurogentec, Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Genetics 2023Quote: ... and then a Takyon SYBR Green PCR kit (Eurogentec) in a StepOnePlus apparatus (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... A region of 168 base pairs on the PB2 protein was amplified by RT-PCR using custom primers (Table S6)(Eurogentec, Maastricht, Netherlands) and the QIAGEN OneStep RT-PCR Kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... were used in a one-step RT-qPCR using the Takyon-One Step RT probe mastermix (Eurogentec) and run on a Roche Light Cycler 96 ...
-
bioRxiv - Microbiology 2022Quote: ... were used in a one-step RT-qPCR using the Takyon-One Step RT probe mastermix (Eurogentec) and run on a Roche Light Cycler 96 ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time PCR (qPCR) using a SYBR Green core qPCR kit (Eurogentec) and an ABI Prism 7000 machine (Applied Biosystems ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... For qPCR MESA blue (Eurogentec, RT-SYS2X-03-+NRWOUB) was used ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-qPCR was carried out using Mesa Blue mastermix (Eurogentec). All reactions were normalised to Gapdh as a control.
-
bioRxiv - Plant Biology 2023Quote: ... We conducted qRT-PCRs with the Takyon No ROX SYBR MasterMix blue dTTP Kit (Eurogentec, Seraing, Belgium) in a LightCycler 480 II (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with Euroscript Reverse Transcriptase/RNase inhibitor (Eurogentec, RT-0125-ER) for reverse transcription of RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... RT-qPCR was performed using MESA Blue SYBR Green Mastermix (Eurogentec). Pre-designed primers were purchaced from OriGene Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed us- ing the Takyon No ROX SYBR MasterMix blue dTTP Kit (Eurogentec, Seraing, Belgium) and the LightCycler 480 II (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR was performed in a Roche LightCycler 480 Instrument II using the Takyon LowROX SYBR kit (Eurogentec). All qRT-PCR experiments were conducted with 3 biological replicates and 3 technical replicates ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCRs were performed using Takyon SYBR Green PCR Mastermix (Eurogentec) on a StepOne thermocycler (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-time PCR was performed in a 20 μL final volume using the Takyon No Rox SYBR kit (Eurogentec). Fluorescence intensity was recorded using a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Developmental Biology 2024Quote: ... qRT-PCR was performed using Takyon Rox SYBR 2x Master mix blue dTTP kit (Eurogentec Cat# UF-RSMT-B0701), with starting concentrations of template of around 10ng/µl and primer concentrations of 0.5µM ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR experiments were performed using TakyonTM Low ROX SYBR MasterMix (Eurogentec, Belgium) with the AriaMx Real-Time PCR system (Agilent Technologies ...
-
bioRxiv - Immunology 2022Quote: ... Smartseq2modified PCR primer (Eurogentec) and TRAC or TRBC1/2 specific primers (Eurogentec ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR was performed on a Applied Biosystems™ QuantStudio™ 5 Real-Time PCR System with SYBR Green PCR MasterMix (Eurogentec). Each reaction was performed on a 1:20 dilution of the cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... Lentiviruses were titrated by SYBR green I-based real-time PCR-enhanced reverse transcriptase (SG-PERT) assay (29, 30) using the Takyon SYBR green kit (Eurogentec). The titer was determined by comparison with a standard curve of known RNA concentrations ...
-
bioRxiv - Neuroscience 2021Quote: ... The reaction mixture for real-time PCR contained Takyon real-time PCR mastermix (Eurogentec) and Taqman primer/probe mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2022Quote: ... or HotGoldStar PCR mix (Eurogentec) using 50 ng total RNA equivalent RT reaction and Endoglin EngExon12fwd 5’-CTGGGCATAGCGTTCGGAGGATT-3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR primers were purchased from Eurogentec and used in PCRs with SYBR Green Master Mix (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: ... Mesa Green qRT-PCR MasterMix (Eurogentec) was added to the cDNA (5 μl for every 2 μl of cDNA) ...
-
bioRxiv - Genetics 2022Quote: ... containing 1× PCR buffer (Silverstar, Eurogentec), 1.5 mm MgCl2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 μl reaction volume was prepared for each reaction using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... A 25 µl reaction volume was prepared for each reaction using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... a 20 µl mixture containing 3 µl of RNA was prepared using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... CD79α and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was measured by RT-qPCR using Takyon SYBR Master Mix (Eurogentec), 100nM of specific primers ...
-
bioRxiv - Physiology 2023Quote: ... Messenger RNA (mRNA) expression levels were assessed by quantitative polymerase chain reaction (RT-qPCR) using Takyon SYBR green (Eurogentec) (primers indicated in supplemental table 1 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... RT-qPCR was performed on the Stratagene 500 MX3005P using a SYBR Green reaction mix (Eurogentec, Cat#10-SN2X-03T). The primers used for mRNA detection of target genes by RT-qPCR are listed in Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... one-step qPCR assay was performed using 5 μL of RNA and Takyon Low rox one-step RT probe Mastermix (Eurogentec) and specific primers and probe targeting E gene ...
-
bioRxiv - Microbiology 2024Quote: ... All RT-qPCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). GLuc was amplified using GLuc forward primer CCTACGAAGGCGACAAAGAG and reverse primer TTGTGCAGTCCACACACAGA and results were normalised by amplifying 18s primer sequences ...
-
bioRxiv - Immunology 2021Quote: ... 10 µl of SYBR Green PCR reaction mix (Eurogentec), including 100 ng of the synthesized cDNA plus an appropriate oligonucleotide primer pair ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR mix contained Takyon qPCR master mix (Eurogentec), 500 nM gene-specific primers ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-qPCR experiments were performed with 4µL of cDNA combined to the Takyon No Rox SYBR MasterMix (Eurogentec, UF-NSMT-B0701), using a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... Real-time PCR was performed with 5x MESA Green (Eurogentec) on Bio-Rad CFX 96 Realtime PCR system ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative PCRs were performed using Mesa Green qPCR MasterMix (Eurogentec) in 384-well plates with a Quantstudio Q5 system (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were added by PCR using HGS Diamond Taq DNA polymerase (Eurogentec). The samples were purified and eluted in 35 μl of EB buffer (MinElute PCR Purification Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNAs were amplified by Q-PCR using 5’ and 3’ oligonucleotides (Eurogentec) specific to each gene ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCR reactions were performed with SYBR Mesa Blue qPCR Mastermix (Eurogentec). Three technical replicates were prepared for each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RT-qPCR amplification was carried out with the dsDNA-specific dye Takyon™ SYBR® 2X qPCR Mastermix Blue (Eurogentec Cat#UF-FSMT-B0701) and monitored in real-time with a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification was conducted using MESA Green qPCR MasterMix Plus Assay (Eurogentec Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...