Labshake search
Citations for Eurogentec :
1 - 50 of 84 citations for PCR Plates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). Primers for viral genes are shown in Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using Takyon™ No ROX SYBR 2X MasterMix blue dTTP (Eurogentec). Primers for cellular and viral genes are shown in S1 table ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCRs were performed using Takyon SYBR Green PCR Mastermix (Eurogentec) on a StepOne thermocycler (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... Smartseq2modified PCR primer (Eurogentec) and TRAC or TRBC1/2 specific primers (Eurogentec ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR was performed on a Applied Biosystems™ QuantStudio™ 5 Real-Time PCR System with SYBR Green PCR MasterMix (Eurogentec). Each reaction was performed on a 1:20 dilution of the cDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... The reaction mixture for real-time PCR contained Takyon real-time PCR mastermix (Eurogentec) and Taqman primer/probe mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2022Quote: ... or HotGoldStar PCR mix (Eurogentec) using 50 ng total RNA equivalent RT reaction and Endoglin EngExon12fwd 5’-CTGGGCATAGCGTTCGGAGGATT-3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR primers were purchased from Eurogentec and used in PCRs with SYBR Green Master Mix (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: ... Mesa Green qRT-PCR MasterMix (Eurogentec) was added to the cDNA (5 μl for every 2 μl of cDNA) ...
-
bioRxiv - Genetics 2022Quote: ... containing 1× PCR buffer (Silverstar, Eurogentec), 1.5 mm MgCl2 ...
-
bioRxiv - Microbiology 2019Quote: ... IS2404 and KR-AB were then tentatively amplified by real-time PCR using RT-PCR reagents (Takyon, Eurogentec, Liège, Belgium) and primers and probes as previously described (8).
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative (q) real time PCR (q-RT PCR) was performed with the MESA Green qPCR MasterMix Plus for SYBR Assay® (Eurogentec) using the Applied Biosystems™ StepOnePlus™ Real-Time PCR System ...
-
bioRxiv - Immunology 2021Quote: ... 10 µl of SYBR Green PCR reaction mix (Eurogentec), including 100 ng of the synthesized cDNA plus an appropriate oligonucleotide primer pair ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR mix contained Takyon qPCR master mix (Eurogentec), 500 nM gene-specific primers ...
-
bioRxiv - Genetics 2023Quote: ... and then a Takyon SYBR Green PCR kit (Eurogentec) in a StepOnePlus apparatus (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... Real-time PCR was performed with 5x MESA Green (Eurogentec) on Bio-Rad CFX 96 Realtime PCR system ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative PCRs were performed using Mesa Green qPCR MasterMix (Eurogentec) in 384-well plates with a Quantstudio Q5 system (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were added by PCR using HGS Diamond Taq DNA polymerase (Eurogentec). The samples were purified and eluted in 35 μl of EB buffer (MinElute PCR Purification Kit ...
-
bioRxiv - Plant Biology 2021Quote: ... using 384-well plates and Takyon Low Rox SYBR MasterMix dTTP Blue (Eurogentec) on material from three independent biological experiments ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative RT–PCR was performed using qPCR MasterMix Plus Low ROX (Eurogentec) and TaqMan Gene Expression Assays (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNAs were amplified by Q-PCR using 5’ and 3’ oligonucleotides (Eurogentec) specific to each gene ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCR reactions were performed with SYBR Mesa Blue qPCR Mastermix (Eurogentec). Three technical replicates were prepared for each sample ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time PCR (qPCR) using a SYBR Green core qPCR kit (Eurogentec) and an ABI Prism 7000 machine (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification was conducted using MESA Green qPCR MasterMix Plus Assay (Eurogentec Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR mix consisted of 1X Goldstar™ DNA polymerase (Eurogentec, Seraing, Belgium) and 400 nM of each primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA was then submitted to quantitative real time PCR using Sybrgreen technology (Eurogentec) on a Stepone apparatus (Applied Biosystems ...
-
Ion transport modulators differentially modulate inflammatory responses in THP-1 derived macrophagesbioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed using the Mesa green qPCR master mix (Eurogentec, Seraing, Germany). All primer sequences were obtained from Primerbank (Table 2) ...
-
bioRxiv - Cell Biology 2019Quote: ... mRNA expression was measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Bioengineering 2023Quote: ... qRT-PCR was performed using Takyon Blue dTTP Master Mix (Eurogentec, #UF-NSMT-B0701). The primer sequencesare provided in Supplementary Table 2 ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification was conducted using MESA Green qPCR MasterMix Plus for SYBR Assay (Eurogentec Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... Real time PCR was performed using Takyon No Rox Sybr 2X masterMix blue dTTp (Eurogentec) with 200 nM of each primer on an iCycler iQ(Bio-Rad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative RT-PCR was performed using Takyon No ROX SYBR Mastermix blue dTTP (Kaneka Eurogentec) in reaction volume 20 μl ...
-
bioRxiv - Neuroscience 2022Quote: ... For qRT-PCR analysis the MESA BLUE qPCR MasterMix Plus for SYBR® Assay (Eurogentec) with 100 ng cDNA as template was used ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA was then amplified by real time PCR reactions using Takyon SYBR Green Supermix (Eurogentec®) and gene-specific primers ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative real-time PCR was performed at 60°C using Takyon ROX SYBR MasterMix (Eurogentec, Belgium) in the CFX384 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... Real-time PCR reactions were performed in duplicate using Takyon ROX SYBR MasterMix blue dTTP (Eurogentec) on an Applied Biosystems QuantStudio 5 (Thermo Fischer Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR reactions were performed in duplicate using Takyon ROX SYBR MasterMix blue dTTP (Eurogentec) on an Applied Biosystems QuantStudio 5 (ThermoFisher) ...
-
bioRxiv - Immunology 2019Quote: ... The expression of CPT1 was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... Extracted DNA was incorporated into real-time PCR performed using Metha_16S_2_MBF: 5’-CGAACCGGATTAGATACCCG -3’ and Metha_16S_2_MBR: 5’-CCCGCCAATTCCTTTAAGTT-3’ primers (Eurogentec, Angers, France) and FAM_Metha_16S_2_MBP 6FAM-CCTGGGAAGTACGGTCGCAAG probe targeting the 16S DNA gene of methanogens ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative Real time PCR (qPCR) was performed using Takyon ROX SYBR 2X MasterMix (Eurogentec UF-RSMT-B0701) as a fluorescent detection dye ...
-
bioRxiv - Plant Biology 2020Quote: ... Reverse transcription quantitative PCR (RT-qPCR) was carried out with Takyon No ROX SYBR mastermix (Eurogentec, Belgium) as in Atkinson et al.17 ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative PCR reactions were carried out using Takyon Low ROX SYBR 2X MasterMix blue dTTP (Eurogentec, Belgium) with a AriaMx real-time PCR system (Agilent Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... We conducted qRT-PCRs with the Takyon No ROX SYBR MasterMix blue dTTP Kit (Eurogentec, Seraing, Belgium) in a LightCycler 480 II (Roche ...
-
bioRxiv - Cell Biology 2023Quote: qRT-PCR reactions were prepared using 1x MESA Blue qPCR MasterMix Plus for SYBR® Assay (Eurogentec), 0.1 µl ROX Reference Dye (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2µl of PCR product was denatured in 10µl HiDi formamide (Thermo) with 0.5µl Mapmarker ROX 1000 (Eurogentec) and run on an ABI 3730XL genetic analyser ...
-
bioRxiv - Pathology 2024Quote: ... All reactions were performed in Biorad® 96-well plates with the reagent kit for TaqMan® qPCR assays (Eurogentec), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... All RT-qPCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). GLuc was amplified using GLuc forward primer CCTACGAAGGCGACAAAGAG and reverse primer TTGTGCAGTCCACACACAGA and results were normalised by amplifying 18s primer sequences ...
-
bioRxiv - Cell Biology 2019Quote: ... mRNA expression was measured by quantitative (Q)-PCR using SYBR Green Mastermix (#RT-SY2X-NRWOU+B, Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Physiology 2019Quote: ... cDNA-specific PCR primers were designed using Primer-BLAST (see Table 1) and purchased from Eurogentec (Seraing, Belgium). Gapdh was used as reference gene ...