Labshake search
Citations for Eurogentec :
1 - 50 of 82 citations for EnzyFluo ERK Phosphorylation Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... using MESA BLUE qPCR kit for SYBR assay (Eurogentec) according to the manufacturer’s instructions with primers for 18S (see Table 1 ...
-
bioRxiv - Plant Biology 2020Quote: ... We used Takyon qPCR Kit for SYBER assay (Eurogentec) and the RT-PCR was carried out in CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... using MESA BLUE qPCR kit for SYBR assay (Eurogentec) according to the manufacturer’s instructions with primers for 18S (see Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: ... 30 s) using Takyon qPCR kit for SYBR assay (Eurogentec) (2.5 µL TAKYON SYBER 2X ...
-
bioRxiv - Microbiology 2019Quote: ... using the Mesa Blue qPCR Mastermix Plus for Sybr assay kit (Eurogentec). Each reaction was performed in triplicate on three separate occasions ...
-
bioRxiv - Molecular Biology 2020Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative polymerase chain reaction (qPCR) was performed with the MESA BLUE qPCR kit for SYBR assay (Eurogentec) on a LightCycler96 system (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... All quantitative polymerase chain reactions (qPCRs) were assembled using the MESA BLUE qPCR kit for SYBR assay (Eurogentec) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... SYBR Green based Product Enhanced Reverse Transcriptase assay (SG-PERT) was performed using the Takyon SYBR green kit (Eurogentec) to quantify HCVpp titers used for infection (74).
-
bioRxiv - Microbiology 2020Quote: ... Lentiviruses were titrated by SYBR green I-based real-time PCR-enhanced reverse transcriptase (SG-PERT) assay (29, 30) using the Takyon SYBR green kit (Eurogentec). The titer was determined by comparison with a standard curve of known RNA concentrations ...
-
bioRxiv - Pathology 2024Quote: ... All reactions were performed in Biorad® 96-well plates with the reagent kit for TaqMan® qPCR assays (Eurogentec), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). Primers for viral genes are shown in Table 1 ...
-
bioRxiv - Microbiology 2024Quote: ... All RT-qPCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). GLuc was amplified using GLuc forward primer CCTACGAAGGCGACAAAGAG and reverse primer TTGTGCAGTCCACACACAGA and results were normalised by amplifying 18s primer sequences ...
-
bioRxiv - Genetics 2019Quote: ... Two custom assays were obtained from Eurogentec (www.uk.eurogentec.com): MPG (Forward ...
-
bioRxiv - Immunology 2024Quote: ... using MESA GREEN qPCR Mastermix Plus for SYBR Assay (Eurogentec). Actb (β-Actin ...
-
bioRxiv - Plant Biology 2019Quote: ... and qPCR using 2x Takyon for SYBR Assay – no ROX (Eurogentec) following the manufactures instructions on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... or the Mesa Green qPCR MasterMix Plus for SYBR Assay (Eurogentec) with the primers listed in S6 Table ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1X MESA GREEN qPCR MasterMix Plus for Sybr® Assay (Eurogentec). qPCR was processed at 95°C for 5min ...
-
bioRxiv - Plant Biology 2021Quote: ... Master mixes of Takyon Master Mix for SYBR® Assay mix (Eurogentec): Water ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers were purchased from Qiagen (miScript Primer Assay range) and from Eurogentec (primer list Supp. Table 4) to respectively amplify miRNA and mRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... with MESA GREEN qPCR MasterMix Plus and SYBR® Assay Low ROX (Eurogentec) for detection ...
-
bioRxiv - Immunology 2020Quote: ... qPCR assays were performed using primers purchased from Eurogentec (Seraing, Belgium; Table 1) and specific for the gene coding for the flaA and flaB subunit genes ...
-
bioRxiv - Cell Biology 2023Quote: ... using MESA GREEN qPCR MasterMix Plus for SYBR® Assay Low ROX (Eurogentec) for detection ...
-
bioRxiv - Plant Biology 2023Quote: ... with MESA FAST qPCR MasterMix Plus for SYBR® Assay No ROX (Eurogentec). The cycling conditions used were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification was conducted using MESA Green qPCR MasterMix Plus Assay (Eurogentec Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Plant Biology 2020Quote: ... WOX9 peptide antibodies used for ChIP assays were synthesized by Eurogentec (https://www.eurogentec.com/en/) using amino acid sequences specific for SRB homolog Phvul.006G179900 and SB homolog Glyma.11G210800 (Fig ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification was conducted using MESA Green qPCR MasterMix Plus for SYBR Assay (Eurogentec Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Neuroscience 2021Quote: ... was performed using the MESA Green qPCR Mastermix Plus for SYBR Assay (Eurogentec,Seraing, Belgium) on a liquid handling robot platform (Tecan Genesis) ...
-
bioRxiv - Neuroscience 2022Quote: ... For qRT-PCR analysis the MESA BLUE qPCR MasterMix Plus for SYBR® Assay (Eurogentec) with 100 ng cDNA as template was used ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed using MESA BLUE qPCR 2X MasterMix Plus for SYBR® Assay (Eurogentec) using a 2-step reaction protocol for 40 cycles and each sample was processed in technical triplicates ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed using MESA BLUE qPCR 2X MasterMix Plus for SYBR® Assay (Eurogentec) using a 2-step reaction protocol for 40cycles with systematic evaluation of primer melting curve ...
-
bioRxiv - Cell Biology 2021Quote: ... or SYBR green assays using the Takyon™ Low Rox SYBR® MasterMix dTTP Blue (Eurogentec).
-
bioRxiv - Cell Biology 2021Quote: ... We performed probe based assays using the Takyon™ Low Rox Probe MasterMix dTTP Blue (Eurogentec) or SYBR green assays using the Takyon™ Low Rox SYBR® MasterMix dTTP Blue (Eurogentec).
-
bioRxiv - Microbiology 2021Quote: ... Quantification of zebrafish transcripts was performed using a SYBR assay using the Takyon SYBR Blue mastermix (Eurogentec) with primer pairs listed on Table 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... on a LightCycler® 96 Instrument or the Mesa Green qPCR MasterMix Plus for SYBR Assay (Eurogentec) on a Stratagene Mx3005P Multiplex Quantitative Real Time PCR System ...
-
bioRxiv - Cell Biology 2023Quote: qRT-PCR reactions were prepared using 1x MESA Blue qPCR MasterMix Plus for SYBR® Assay (Eurogentec), 0.1 µl ROX Reference Dye (Invitrogen) ...
-
bioRxiv - Pathology 2024Quote: ... The optimal primer concentration was 300 nM with MESA Green qPCRTM Mastermix Plus for SYBR® Assays (Eurogentec) and 100 nM for TaqMan® probes ...
-
bioRxiv - Plant Biology 2021Quote: ... Gene expression was measured by qPCR using MESA BLUE qPCR MasterMix Plus for SYBR® Assay No ROX (Eurogentec) and cycle quantification by Biorad CFX system.
-
bioRxiv - Developmental Biology 2021Quote: ... PCR amplification was performed using MESA Green qPCR MasterMix for SYBR assay (Cat. No. RT-SY2X-03+WOUN, Eurogentec, Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). For real time based quantification to study comparative differential expression here are list of primers that has been used ...
-
bioRxiv - Genomics 2019Quote: ... All quantitative PCR assays were performed in duplicate with Mesa green qPCR 2x MasterMix Plus (Eurogentec 05-SY2X-06+WOU) on a CFX96 PCR system (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative PCR was then performed using an ABI7500 Fast instrument and the MESA Green qPCR MasterMix Plus for SYBR assay (Eurogentec). Relative expression was calculated via the Pfaffl method79 using Gapdh and Polr2a as references gene ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). 18s rRNA has been used as endogenous control.
-
bioRxiv - Microbiology 2021Quote: ... one-step qPCR assay was performed using 5 μL of RNA and Takyon Low rox one-step RT probe Mastermix (Eurogentec) and specific primers and probe targeting E gene ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using Takyon™ No ROX SYBR 2X MasterMix blue dTTP (Eurogentec). Primers for cellular and viral genes are shown in S1 table ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative (q) real time PCR (q-RT PCR) was performed with the MESA Green qPCR MasterMix Plus for SYBR Assay® (Eurogentec) using the Applied Biosystems™ StepOnePlus™ Real-Time PCR System ...
-
bioRxiv - Plant Biology 2023Quote: Gene expressions were measured by mixing 4.3 µL of a 100 fold diluted cDNA suspension with 7.5 µL of MESA Blue 2X PCR MasterMix for SYBR Green Assays with fluorescein (Eurogentec, Liege, Belgium). The mix is complemented with 3 µL of primers according to the optimal concentration allowing an efficiency close to 100% and calculated in previous experiments ...
-
bioRxiv - Molecular Biology 2024Quote: A poly(GP) Meso Scale Discovery (MSD®) enzyme-linked immunosorbent assay (ELISA) was established using a custom made rabbit αLGP antibody (Eurogentec) and based on previously described methods16 ...
-
bioRxiv - Molecular Biology 2021Quote: ... random nonamers (Eurogentec Reverse Transcriptase Core Kit) was used to prepare cDNA by using the 200 ng of the total RNA for 10 μl of reaction and the produced cDNA was used for comparative quantitation of mRNA expression ...