Labshake search
Citations for Eurogentec :
1 - 50 of 88 citations for Creatinine Serum Low Sample Volume Kit 384 well Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... using 384-well plates and Takyon Low Rox SYBR MasterMix dTTP Blue (Eurogentec) on material from three independent biological experiments ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 μl reaction volume was prepared for each reaction using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... A 25 µl reaction volume was prepared for each reaction using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Total volume of qPCR reaction was 20µl and it contained 10µl of 2x qPCR Master Mix Low ROX (Eurogentec), 1µl of 20x TaqMan Gene Expression Assay (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Total volume of qPCR reaction was 20µl and it contained 10µl of 2x qPCR Master Mix Low ROX (Eurogentec), 1µl of 20x TaqMan Copy Number Assay (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: Quantitative PCR was performed in a total reaction volume of 12.5 μl containing 6 μl Takyon™ Low Rox SYBR® MasterMix dTTP Blue (Eurogentec), 0.5 μl of each primer (5μM) ...
-
bioRxiv - Microbiology 2020Quote: ... gondii γH2A.X serum sample was obtained from Eurogentec (Belgium) on the basis of the peptide NH2-C+ GKHGV-S(PO3H2)-QEF −COOH ...
-
bioRxiv - Pathology 2024Quote: ... All reactions were performed in Biorad® 96-well plates with the reagent kit for TaqMan® qPCR assays (Eurogentec), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNA real time quantification was generally performed in a two step format using Eurogentec Reverse Transcriptase Core Kit and MESA GREEN qPCR Master Mix Plus for SYBR Assay with Low Rox kit from Eurogentec following the suppliers’ protocols ...
-
bioRxiv - Microbiology 2021Quote: ... DNA eluted into 100 μl sample volume was tested in quantitative-PCRs (qPCRs) using primers and probes (Eurogentec, Seraing, Belgium) targeting sequences within metA ...
-
bioRxiv - Cell Biology 2023Quote: ... TaqMan 2× Mastermix Plus – Low ROX (Eurogentec), and the related TaqMan assays together with 8 µl of the diluted DNA samples (n=3) ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-time PCR was performed in a 20 μL final volume using the Takyon No Rox SYBR kit (Eurogentec). Fluorescence intensity was recorded using a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... and TaqMan 2× Mastermix Plus – Low ROX (Eurogentec) on a ViiA 7 thermocycler (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2024Quote: Transcript expression was assessed using low ROX Takyon (Eurogentec) on 1:25 diluted cDNA with the CFX96 real-time system (BIORAD ...
-
bioRxiv - Plant Biology 2023Quote: ... and Takyon Low Rox SYBR MasterMix dTTP Blue (Eurogentec). Samples were obtained from three independent biological experiments ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). Primers for viral genes are shown in Table 1 ...
-
bioRxiv - Microbiology 2024Quote: ... All RT-qPCR assays were carried out in 96-well plates using MESA Blue qPCR MasterMix Plus for SYBR Assay (Eurogentec). GLuc was amplified using GLuc forward primer CCTACGAAGGCGACAAAGAG and reverse primer TTGTGCAGTCCACACACAGA and results were normalised by amplifying 18s primer sequences ...
-
bioRxiv - Microbiology 2022Quote: ... All qRT-PCR assays were carried out in 96-well plates using Takyon™ No ROX SYBR 2X MasterMix blue dTTP (Eurogentec). Primers for cellular and viral genes are shown in S1 table ...
-
bioRxiv - Microbiology 2023Quote: ... a 20 µl mixture containing 3 µl of RNA was prepared using the Low ROX One-Step qRT-PCR 2X MasterMix kit (Eurogentec®, Seraing, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative RT–PCR was performed using qPCR MasterMix Plus Low ROX (Eurogentec) and TaqMan Gene Expression Assays (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time qPCR was performed using qPCR Mastermix Plus – Low ROX (Eurogentec) on a ViiA 7 thermocycler (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... we used Taykon™ Low Rox SYBR MasterMix dTTP blue (Eurogentec, Liege, Belgium) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... with MESA GREEN qPCR MasterMix Plus and SYBR® Assay Low ROX (Eurogentec) for detection ...
-
bioRxiv - Cell Biology 2023Quote: ... using MESA GREEN qPCR MasterMix Plus for SYBR® Assay Low ROX (Eurogentec) for detection ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR experiments were performed using TakyonTM Low ROX SYBR MasterMix (Eurogentec, Belgium) with the AriaMx Real-Time PCR system (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... the serum was yielded (Eurogentec).
-
bioRxiv - Immunology 2024Quote: ... followed by qPCR using the Takyon Low Rox Probe Master mix dTTP Blue (Eurogentec) and primers/probe pre-designed assays (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... or SYBR green assays using the Takyon™ Low Rox SYBR® MasterMix dTTP Blue (Eurogentec).
-
bioRxiv - Cell Biology 2021Quote: ... We performed probe based assays using the Takyon™ Low Rox Probe MasterMix dTTP Blue (Eurogentec) or SYBR green assays using the Takyon™ Low Rox SYBR® MasterMix dTTP Blue (Eurogentec).
-
bioRxiv - Microbiology 2019Quote: qPCR on 100-fold diluted samples was performed using the Takyon ROX SYBR Mastermix blue dTTP kit (Eurogentec) and the StepOnePlus real time PCR system (Applied Biosystem) ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative PCR reactions were carried out using Takyon Low ROX SYBR 2X MasterMix blue dTTP (Eurogentec, Belgium) with a AriaMx real-time PCR system (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... 2Y4824 rabbit anti-pre-immune serum (PIS; Eurogentec) was used for control purposes ...
-
bioRxiv - Microbiology 2024Quote: ... with a reaction volume of 15 µL containing 7.5 µL of Takyon Master Mix (Eurogentec, Liège, BE), 1 µM of each primer ...
-
bioRxiv - Physiology 2019Quote: ... technical triplicates were performed on 5 ng of cDNA using Takyon Low ROX SYBR 2X MasterMix blue dTTP (Eurogentec) on a ViiA™7 thermal cycler (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). For real time based quantification to study comparative differential expression here are list of primers that has been used ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time (reverse transcriptase) PCR from cDNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec). 18s rRNA has been used as endogenous control.
-
bioRxiv - Microbiology 2021Quote: ... one-step qPCR assay was performed using 5 μL of RNA and Takyon Low rox one-step RT probe Mastermix (Eurogentec) and specific primers and probe targeting E gene ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was used for real-time PCR analysis using Takyon Low Rox Probe 2x Master Mix dTTP Blue (Eurogentec, Liège, Belgium) with TaqMan® Assay-on-demand kits (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was amplified in a 20 µl PCR mix containing 10 µl of Takyon Low Rox SYBR MasterMix dTTP Blue (Eurogentec, Belgium), 2 µl of each primer (final concentration 300 nM) ...
-
bioRxiv - Plant Biology 2022Quote: ... First-strand cDNAs were synthesized from 1 μg of total RNA in 20 μl final volume using an oligo-dT(18)-MN primer (Eurogentec, France) and the Omniscript RT kit (Qiagen) ...
-
bioRxiv - Pathology 2023Quote: ... The qPCR on sylC was also performed in a final volume of 20 µL containing 10 µL of MasterMix buffer (Eurogentec, Belgium), 900 nM of each primer ...
-
bioRxiv - Physiology 2019Quote: ... and each sample was run in triplicate with 2 µL of the diluted cDNA and 8 µL of master mix containing 1x qPCR MasterMix Plus Low ROX (Eurogentec, Liège, Belgium) or 1x TaqMan gene expression MasterMix (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCR (qPCR) was performed on the synthesised cDNA using Takyon™ Low ROX SYBR®master mix ddTTP blue (Eurogentec Liège, Belgium). qPCR was performed in three technical replicates and a non-template control was included ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... qPCR was done using an Applied Biosystems 7500 Fast Instrument with Quantitation -Standard Curve experimental type and Takyon Low ROX SYBR 2X MasterMix blue dTTP (Eurogentec cat# UF-LSMT-B0710) using three-step protocol for optimal sensitivity and 45 cycles in total ...
-
bioRxiv - Physiology 2022Quote: ... Samples were analysed using MESA Blue SYBR (Eurogentec) and primers (See Supplementary Table 3 ...
-
bioRxiv - Genomics 2021Quote: ... in a final volume of 10 µL (0.5 µL of each primer, 5 µL of Eurogentec Takyon™ SYBR® 2 x qPCR Mastermix Blue). The following Light-Cycler run protocol was used ...
-
bioRxiv - Microbiology 2023Quote: ... 100 μl/well polyclonal rabbit antiserum against p24 antigen (Eurogentec, 1:1,000 in PBS-T with 10% (v/v) FCS ...
-
bioRxiv - Biochemistry 2022Quote: ... The difference is that the samples were ran on a pre-cast 8% polyacrylamide gel (Eurogentec), which was afterwards stained with 10% CBB and destained to be sent for mass spectrometry analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... Technical duplicates for every sample were amplified using the Takyon ROX SYBR 2X MasterMix dTTP blue (Eurogentec) in a StepOnePlusTM Real-Time PCR Detection System (Applied Biosystems) ...