Labshake search
Citations for Eurogentec :
1 - 39 of 39 citations for CYP2B9 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Individual siRNA sequences (Eurogentec) were used for SUN1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Control cells were electroporated with a scramble siRNA (siRNA-negative control duplex; Eurogentec).
-
bioRxiv - Cell Biology 2020Quote: Double-stranded siRNA oligonucleotides used were 5’- CAGUACCAGUGAGUGGCCCCACCUG-3’ (NuMA 3’UTR siRNA; Eurogentec) and 5’-CACCGUGUGUCUAAGCAAA-3’ (RCC1 siRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... siRNA duplex of RPS26 (Eurogentec) (GenBank accession number ...
-
bioRxiv - Cell Biology 2020Quote: ... ERRα siRNAs were from Eurogentec; ERR#1(GGCAGAAACCUAUCUCAGGUU) ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...
-
bioRxiv - Biophysics 2022Quote: ... siRNAs were ordered from Eurogentec: siNup153 according to the sequence in (80 ...
-
bioRxiv - Biochemistry 2022Quote: Transient siRNA-mediated knockdown was performed by transfecting HEK293 cells with 33 nM siRNA oligonucleotides (Eurogentec) targeting the transcript of interest (see Supplementary Table S1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Other siRNAs were purchased from Eurogentec including siKDM5A-2 ...
-
bioRxiv - Cell Biology 2021Quote: ... control siRNA (Eurogentec, SR-CL000-005); for human SphK2 5’ GCUGGGCUGUCCUUCAACCU 3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Sp1 siRNA (purchased from Eurogentec) at a dose of 1 nM in 12 wells following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Non-targeting control siRNA and siRNA duplexes targeting Sorbs1 (5’-UUAAGUCCUGAGUGCUCUUC-3’) were synthesized and purchased from Eurogentec.
-
bioRxiv - Cell Biology 2020Quote: ... and 5’-CACCGUGUGUCUAAGCAAA-3’ (RCC1 siRNA; Eurogentec).
-
bioRxiv - Cell Biology 2021Quote: ... siRNA HIF-1α (target sequence: CACCATGATATGTTTACTA, Eurogentec).
-
bioRxiv - Microbiology 2020Quote: ... the siRNAs were ordered from Eurogentec (Eurogentech). Cells were seeded and transfected using Lipofectamin RNAiMAX (Thermofisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... using Lipofectamine RNAiMAX (Invitrogen #11668-019)-siRNA transfection (siCtr – Eurogentec SR-CL011-005). SiRNA targeting sequences for human Nme1 and Acly are reported in the key resources table.
-
bioRxiv - Developmental Biology 2023Quote: ... and 50 nM synthetic siRNA duplexes (Eurogentec) targeting either Srrm2 or firefly luciferase (Gl2) ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were incubated in Opti-MEM for 5–6 h with Ambion pre-designed Silencer-Select siRNA or custom-designed siRNA from Eurogentec or scrambled siRNA (control siRNA ...
-
bioRxiv - Immunology 2022Quote: ... were purchased from Dharmacon or Wnt5a siRNA (Cat no.-SR-NP001-001) and control siRNA (Cat no.-SR-CL000-005) were purchased from Eurogentec. cDNA synthesis kit (Cat no.-BB-E0045 ...
-
bioRxiv - Cell Biology 2019Quote: ... For Control: Scrambled siRNA (Eurogentec SR-NP001-001) or siGENOME Non-Targeting Pool #1 (Dharmacon ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA oligos were purchased from Eurogentec (Seraing, Belgium) along with control siRNA (SR-CL000-005) ...
-
bioRxiv - Cell Biology 2022Quote: ... Targeting and control siRNAs were synthesized by Eurogentec, Belgium ...
-
bioRxiv - Molecular Biology 2022Quote: siRNAs used in this study were from Eurogentec:
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transfection of siRNAs (Eurogentec, Belgium; Table S2) was performed using Lipofectamine RNAimax (ThermoFischer Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cyp1b1 or a negative control siRNA (Eurogentec, Belgium) were done using Lipofectamine RNAiMAX reagent (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Fibronectin siRNA was custom-synthesized by Eurogentec (Liège, Belgium). The rat DDR2/CD167b Gene ORF cDNA clone expression plasmid was obtained from Sino Biologicals (Beijing ...
-
bioRxiv - Molecular Biology 2020Quote: ... SRF siRNAs were custom-designed from Eurogentec (Liege, Belgium). Signal Silence ® P44/42 MAPK (ERK1/2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a final concentration of 20 nM siRNA (Eurogentec or Dharmacon ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNAs and oligonucleotides were purchased from Eurogentec (Seraing, Belgium).
-
bioRxiv - Molecular Biology 2022Quote: ... Fibronectin siRNA was custom-synthesized by Eurogentec (Liège, Belgium). The rat DDR2/CD167b Gene ORF cDNA clone expression plasmid was obtained from Sino Biologicals (Beijing ...
-
bioRxiv - Cell Biology 2023Quote: The following target siRNA sequences were synthesized from Eurogentec, Belgium ...
-
bioRxiv - Cell Biology 2021Quote: ... the siRNA against AURKA was synthesised and purchased from Eurogentec, as previously described (Bertolin et al. ...
-
bioRxiv - Cell Biology 2022Quote: The sequences of siRNA for p150Glued are obtained from Eurogentec: GGUAUCUGACACGCUCCU and UAGGAGCGUGUCAGAUAC ...
-
bioRxiv - Cell Biology 2023Quote: ... hGBF1 (5’- CCUCUGUCAACAAGUUCCU-3’) and control siRNA was purchased from Eurogentec. Following plasmids used in this study were described previously ...
-
bioRxiv - Biochemistry 2022Quote: The double-stranded interfering RNAs (siRNAs) were purchased from Eurogentec (Liège, Belgium). The following siRNAs were used in this work:SDCBP sense (5 ‘-GCAAGACCUUCCAGUAUAA-3’) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected using Interferin (Polyplus Transfection) with siRNA oligonucleotide duplexes (Eurogentec, Belgium). The sequences of the siRNA duplexes were ...
-
bioRxiv - Cell Biology 2022Quote: The following target siRNA sequence against the respective gene were synthesized from Eurogentec, Belgium ...
-
bioRxiv - Cell Biology 2021Quote: ... The siRNAs used to deplete SFI1 were designed as described in (Balestra et al., 2013) and purchased from Eurogentec. The sequences are as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 30 ng/mL M-CSF and 50 ng/mL RANKL as described (Touaitahuata et al.. 2016) using 100 nM siRNA: either Dharmacon siGenome Smartpools or custom oligonucleotides from Eurogentec (Table S11). After 3 hours ...