Labshake search
Citations for Mirus Bio :
1 - 50 of 70 citations for Recombinant E. coli LT IIa His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged E-cadherin or with constructs encoding E-cadherin and TNFα RUSH system using TransIT-LT1 Reagent (Mirus, MIR 2305) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... and TransIT-LT (Mirus) were combined and incubated at room temperature for 20 minutes before being added to the cells ...
-
bioRxiv - Microbiology 2020Quote: ... and TransIT-LT (Mirus) were combined using pipetting and incubated at room temperature for 20min before being added to cells by droplet.
-
bioRxiv - Microbiology 2020Quote: ... or Transit LT-1 (Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Transit LT-1 (Mirus).
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was performed using TransIT-LT-1 (Mirus) transfection reagent and 2500ng plasmid/flask ...
-
bioRxiv - Genomics 2020Quote: ... Transit LT-1 reagent (cat. # MIR 2300) from Mirus Bio ...
-
bioRxiv - Microbiology 2022Quote: ... by Trans IT LT-1 (Mirus Bio, Madison, WI). Single cell clones were established by the limit dilution method ...
-
bioRxiv - Genomics 2023Quote: ... Transit LT-1 reagent (cat. # MIR 2300) from Mirus Bio ...
-
bioRxiv - Microbiology 2022Quote: ... indicated plasmids were transfected using LT-1 Reagent (Mirus) and cells were then fixed with 5% methanol-free formaldehyde or treated with IFN or TNF-alpha before fixation ...
-
bioRxiv - Molecular Biology 2019Quote: ... RRE and REV using TransIT LT-1 transfection reagent (Mirus). Viral transductions were performed in the presence of 4-8 µg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 µL LT-1 transfection reagent (#MIR2020, Mirus Bio LLC), and 1 µL brain lysate (1ug/uL stock determined by BCA (5000001 ...
-
bioRxiv - Genetics 2019Quote: ... two master mixes were prepared: a) LT-1 transfection reagent (Mirus) was diluted 1:10 in Opti-MEM and incubated for five minutes ...
-
bioRxiv - Microbiology 2022Quote: ... by using the TransIT LT-1 transfection reagent (Mirus Bio LLC). Two days later ...
-
bioRxiv - Microbiology 2022Quote: ... Sigma-Aldrich) via the LT-1 transfection reagent (Mirus Bio LLC) in A549 or 293T cell propagation medium ...
-
bioRxiv - Cell Biology 2023Quote: ... and pCG-VSV-G using TransIT-LT-1 transfection reagent (Mirus). Subsequently ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Genetics 2022Quote: ... We used a reverse transfection method (Mirus-IT LT transfection reagent, Mirus Bio) to introduce sgRNA containing plasmid into the CRISPRn/WTC-11 cells ...
-
bioRxiv - Genetics 2022Quote: ... We used a reverse transfection method (Mirus-IT LT transfection reagent, Mirus Bio) to introduce sgRNA containing plasmid into the CRISPRn/WTC-11 cells ...
-
bioRxiv - Biochemistry 2023Quote: ... transfected with 9 μg HA-tagged and 9 μg Flag-tagged constructs using TransIT-LT1 transfection reagents (Mirus). The transfected cells were cultured for another two days ...
-
bioRxiv - Cell Biology 2024Quote: ... and PEX19 sgRNAs were transfected in 96-well plates by lipofectamine (TransIT LT-1, Mirus). A normalized 55 ng of total plasmid DNA was used at a ratio of 50:5 TOPFlash/FOPFlash:Renilla ...
-
bioRxiv - Biochemistry 2023Quote: ... S462 cells were transfected with the guide RNA and the repair template using TransIT LT (Mirus). Cells were selected with G418 ...
-
bioRxiv - Immunology 2021Quote: ... Retroviral particles were produced by transfection of Platinum E (PLAT-E) cells with the TransIT-LT1 transfection reagent (Mirus) in Opti-MEM I reduced serum medium ...
-
bioRxiv - Microbiology 2022Quote: ... The CPER products were then directly transfected into HEK293-C34 cells using Trans IT LT-1 (Mirus). At 6 hours post-transfection ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were transfected with the plasmids by using Trans IT LT-1 transfection reagent (Mirus, Madison, WI) according to the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2019Quote: ... cultured in Schneider’s Drosophila Medium containing 10% heat-inactivated FBS and 1X penicillin-streptomycin with the TransIT-LT 1 reagent (Mirus). Flag-CG30403 only (no bait ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Biochemistry 2023Quote: ... plasmids were transfected in duplicate into HEK293T cells in a 48-well plate using LT-1 transfection reagent (Mirus) with the indicated plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... lentiviral particles were generated by transient transfection of the lentiviral packaging Lenti-X 293T cells (Takahara) with the TCR encoding plasmids and packaging plasmids (VSVg and PSPAX2) 25 using Transit LT-1 (Mirus). Lentiviral supernatant was harvested 2 days later ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral particles were produced by co-transfection of shRNA plasmids with psPAX and pMDG.2 in 293T cells using the Trans-IT LT-1 transfection reagent (Mirus). DM cells were infected by shRNA lentivirus twice via spinoculation in the presence of 5 μg/mL polybrene (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: The CPER products (25 μl out of a 50 μl reaction volume) were transfected into HEK293-3P6C33 cells or BHK-21 cells with Trans IT LT-1 (Mirus), following the manufacturer’s protocols ...
-
bioRxiv - Immunology 2021Quote: ... transfected with 44 μg plasmid encoding SARS-CoV-2 Spike (pCG1-SARS-2-S, Wuhan Hu-1) using Transit LT-1 (Mirus). The next day ...
-
bioRxiv - Microbiology 2022Quote: HeLa cells were seeded in 6 well plates (2.0×105 per well) and incubated overnight before transfection with pCAGGS-VP40 using lipofectamin LT-1 (MIR2304; Mirus Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected overnight with either a control plasmid (PLX) or TMPRSS2 (PLX-TMPRSS2) via TransIT LT-1 transfection reagent (Mirus Bio) in 100 µL of OptiMEM per well ...
-
bioRxiv - Immunology 2022Quote: Monolayers of BSC-40 cells were infected with parental IHD-J at an MOI of 0.01 PFU/cell and transfected 1 hour later with 10 μg of DNA of plasmid pCyA-ISG15GG (pCyA was kindly provided by Mariano Esteban) using LT-1 (Mirus Bio) according to manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors were produced in HEK-293T cells by co-transfection of the previously sequenced vector constructs with psPAX and pMDG.2 packaging plasmids using Trans-IT LT-1 (Mirus, MIR2700). HEK293T cells were incubated overnight at 37°C and the next day medium was changed for IMDM 10% HI-FBS ...
-
bioRxiv - Microbiology 2023Quote: RBP-overexpressing Huh7 cells were generated by transfection of RBP expression plasmids using TransIT LT-1 transfection reagent (Mirus, WI, USA). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... and RdRp-N462 or RdRp-D462 were transfected into 293T cells at a 1:1:1 ratio using TransIT LT-1 (Mirus, Madison, WI). To normalize transfection efficiency ...
-
bioRxiv - Cell Biology 2019Quote: ... 250 ng lentiviral vector was co-transfected with a mix of third-generation lentivirus packaging vectors (250 ng total) using Mirus LT-1 transfection reagent (Mirus Bio LLC). Three days post-transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral vectors were incubated with 3rd generation viral packaging vectors (pCMV-VSV-G, pMDLg/pRRE, pRSV-Rev) and LT-1 (Mirus, MIR-2305) in OPTI-MEM media for 30 minutes as described by the provider’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... and eIF2αS/S or eIF2αA/A MEF cells were transiently transduced with TauRD(P301S)-YFP plasmid using TransIT LT-1 Transfection reagent (#MIR2020, Mirus Bio LLC) and virally transduced by lab-prepared lentiviral infection following manufacturer’s instruction and incubated for 2 days ...
-
bioRxiv - Microbiology 2021Quote: ... cells were transfected with 3 µg of either each GPC expression plasmid or pCAGGS empty vector using TransIT LT-1 reagent (Mirus, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... 106 293T cells in a 2-mL culture volume were seeded overnight in a 35-mm dish before transfection using the TransIT LT-1 transfection reagent (Mirus Bio, Madison, WI). For each dish ...
-
bioRxiv - Microbiology 2024Quote: ... 106 293T cells in a 2-mL culture volume were seeded overnight in a 35-mm dish before transfection using the TransIT LT-1 transfection reagent (Mirus Bio, Madison, WI). For each dish ...
-
bioRxiv - Cell Biology 2023Quote: ... was then transfected into SH-SY5Y cells (50-60% confluent) in a 6-well plate using TransIT LT-1 reagent (Mirus Bio, Cat# MIR-2300). After 48 hr ...
-
bioRxiv - Neuroscience 2023Quote: ... and a Venus-tagged N-terminal β-arrestin2 using 3:1 ratio of TransiT-2020 (Mirus). 5-HT2A receptor mutants were designed and performed using Q5 mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were transfected with 250 ng of plasmid expressing HA-tagged M polyprotein using TransIT-LT1 (Mirus) and after 6 h cells were treated with 1 µM Pon A or DMSO as a control ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP- and FLAG-tagged proteins under the control of the Actin promoter using TransIT-LT1 reagent (Mirus). 24-40 h after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were transfected with 7.7 µg of a plasmid expressing HA-tagged M polyprotein using TransIT-LT1 (Mirus) and after 6 h the cells were treated with either DMSO or 1 µM ponasterone A (Pon A) ...