Labshake search
Citations for Mirus Bio :
1 - 50 of 57 citations for IL 5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... in which human ACE2 and TMPRSS2 are induced by tetracycline (HEK293-3P6C33 cells) with TransIT-LT1 Transfection Reagent (Mirus, Madison, WI, USA), following the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293 cells were transfected with TransIT-293 (Mirus) according to manufacturer’s instructions with three plasmids ...
-
bioRxiv - Physiology 2021Quote: HEK293 cells were transiently transfected with TransIT-LT1 reagent (Mirus) with channel cDNA and hERG1a N-terminal domain cDNAs in a 2:1 ratio in co-expression experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... H1 plasmid library with the top 5 sgRNA per gene21 were transfected into HEK293s using the TransIT®-Lenti Transfection Reagent (Mirus, Cat. No. MIR 6606) along with third generation lentiviral packaging mix ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The plated HEK293 cells were transfected using TransIT DNA transfection reagent (Mirus) following the instructions supplied by the manufacturer and incubated until use ...
-
bioRxiv - Cell Biology 2023Quote: ... and transfected into HEK293 cells (ECACC) using TransIT-293 (Mirus Bio LLC), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells were transfected using TransIT-293 transfection reagent (Mirus Bio LLC). For transient expression of human Siglec-5-GFP 80% confluent HEK293 in 8 well chamber slide (0.25 ml/well ...
-
bioRxiv - Neuroscience 2024Quote: ... transiently expressed in HEK293 cells using TransIT-293 transfection reagent (Mirus, Madison, WI), and characterized using whole-cell patch-clamp electrophysiology and single cell calcium microfluorimetry as described above.
-
bioRxiv - Neuroscience 2023Quote: HEK293 cells were transfected to produce lentiviral particles with TransIT-Lenti transfection reagent (Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: U20S or HEK293 cells were transfected with the TransIT-XL reagent (Mirus Bio, Madison, WI) with PRK-TK-Neo plasmids encoding for ovalbumin-derived peptides with a signal sequence (MGGTAARLGAVILFVVIVGLHGVRG - based on the signal sequence of Human Herpes Virus 1 Glycoprotein D ...
-
bioRxiv - Immunology 2020Quote: HeLa cells were transfected using TransIT-HeLaMONSTER and HEK293 cells using TransIT-293 (both from Mirus). Cells after transfection were cultured both with and without ProS or HS in the medium ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Cell-free viruses were produced by transfection of HEK293 cells with pNL4-3 using TransIT-LT1 (Mirus) or Fugene HD (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... The CPER products were then directly transfected into HEK293-C34 cells using Trans IT LT-1 (Mirus). At 6 hours post-transfection ...
-
bioRxiv - Microbiology 2021Quote: ... The half of CPER product was transfected into IFNAR1-deficient HEK293 cells TransIT-LT1 transfection reagents (Mirus), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: HEK293 were transfected with pMTBS and pCS2-ST at ~80% confluence using TransIT-293 transfection reagent (Mirus). Cells were harvested for downstream applications 48 hours post-transfection.
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells (150 cm2 dish) were transfected with 6 μg of each protein-coding plasmid by using TransIT (Mirus). Cell lysis and elution were performed as described above ...
-
bioRxiv - Cell Biology 2022Quote: ... for transfection of HEK293 Flp-In T-REx cells and 2 ul Trans-IT-HeLa and 1.3 ul Monster (MIR 2900, Mirus) for HeLa Flp-In T-REx cells ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Viral stocks of NL43 were produced by transfection of HEK293 cells with the molecular clone plasmid using TransIT-LT1 (Mirus) transfection reagent ...
-
bioRxiv - Microbiology 2019Quote: ... NL4-3 and NL4-3(AD8) HIV viral stocks were produced by transfection of HEK293 cells with the molecular clone plasmids using TransIT-LT1 (Mirus) transfection reagent ...
-
bioRxiv - Microbiology 2020Quote: The CPER products (25 μl out of a 50 μl reaction volume) were transfected into HEK293-3P6C33 cells or BHK-21 cells with Trans IT LT-1 (Mirus), following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... Lentiviruses for transduction of LTR-mCherry reporter and expression of HIV receptors (CD4, CXCR4, and CCR5) was generated by transfection of HEK293 cells using the Mirus TransIT transfection kit (Mirus). The resulting supernatant was cleared of debris by low-speed centrifugation (300g for 5 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... carrying the sequence of the gene to be over expressed and resistance to puromycin into 0.8×106 HEK293 cells in a 60 mm culture dish with 6 µl of TrasnIT (Cat. Nº: Mirus Bio. 293) containing 3 ml of complete media ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Immunology 2021Quote: Human Alveolus Chips were transfected with plasmid DNA using the TransIT-X2 reagent (Mirus Bio). 3 ug of plasmid DNA and 6 ul TransIT-X2 reagent were constituted in 300 ul OPT-MEM before added to 3 ml chip flow medium ...
-
bioRxiv - Biochemistry 2021Quote: Human POLA1 (NP_058633.2) and POLA1Δ1-337 was cloned into the pOET1 transfer vector (Mirus Bio). Human PRIM1 (NP_000937.1) ...
-
bioRxiv - Physiology 2023Quote: We cloned the coding sequences of human TSHB and CGA into pLIVE vectors (Mirus Bio, Madison, WI) using a polymerase chain reaction (PCR ...
-
bioRxiv - Bioengineering 2022Quote: Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Systems Biology 2021Quote: ... torque teno virus hypothetical protein or human respirovirus 3 D protein were transfected into the cells using TransIT-LT1 (Mirus Bio) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... in HK-2 human proximal tubule cells at approximately 70% confluency in 96-well plates by using TransIT-2020 Reagent (Mirus, #5404), following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: Plasmid expressing HA-tagged human WFS1 was transfected into HeLa cells using TransIT-X2® Dynamic Delivery System (Mirus Bio; MIR 6000). After 24 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2019Quote: ... VSV-G pseudotyped lentiviral vectors were produced by transfection of human embryonic kidney cells (HEK293FT) with third-generation lentivirus plasmids using lipofection (Mirus TransIT®-293). Supernatant was collected 48 h after transfection and concentrated using ultrafiltration (Centricon Plus-20 PLGC centrifuge filter units).
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with 5 μg of pACT-GFP-actin using TransIT-Insect transfection reagent (Mirus Bio) and incubated for 2 d at 28°C in Grace’s media with 10% FBS and antibiotics (100 μg/ml penicillin/streptomycin and 0.25 μg/ml Amphotericin B) ...
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v1 or hDel-v2 lentiviral sgRNA library at a target infection rate of 25% ...
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v3 lentiviral sgRNA library at a target infection rate of 10% ...
-
bioRxiv - Cell Biology 2024Quote: ... The human AD293 and iPSC cell lines were transfected using the Mirus TransIT®-LT1 Transfection Reagent (Cat # MIR 2300, Mirus Bio LLC, Madison, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μg of pSBbi or pSBtet containing gene of interest using TransIT-LT1 transfection reagent (Mirus Bio), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... together with the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at a 10:7.5:5 ratio using TransIT-293 reagent (Mirus). The supernatant containing the viral particles was collected 48 hrs after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cell Biology 2024Quote: ... the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at 10:7.5:5 ratio using TransIT-293 Transfection Reagent (MIR2704, Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... were transfected with 2·5 µg serine protease expression plasmid or empty vector using TransIT-X2 Dynamic Delivery System (Mirus). One day later ...
-
bioRxiv - Immunology 2022Quote: H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
bioRxiv - Cell Biology 2022Quote: Plasmids for expression of kinesin-1 or any of the kinesin-6 family motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP or GMAP210p-mRFP-2xFKBP at a ratio of 5:1 with TransIT-LT1 transfection reagent (Mirus). Eighteen hours after transfection ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transfected with 10 ug of the TRE library ± 5 ug of pcDNA3.1 containing a GPCR expression cassette using TransIT-2020 (Mirus Bio) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Medium was changed 24 h later to 10 ml of 5 % FBS/DMEM and changed again 48 h later to 10 ml of 5 % FBS/DMEM containing 1 µg/ml of puromycin (Mirus). Cells were incubated in selection medium for 72 h ...