Labshake search
Citations for Mirus Bio :
101 - 150 of 234 citations for 6H Imidazo 4 5 h quinolin 6 one 1 9 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... together with the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at a 10:7.5:5 ratio using TransIT-293 reagent (Mirus). The supernatant containing the viral particles was collected 48 hrs after transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at 10:7.5:5 ratio using TransIT-293 Transfection Reagent (MIR2704, Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lentivirus expressing RIPK3 shRNA was generated by transfecting HEK-293T cells in 6 well plate with a 1: 0.1: 1 ratio of pMDG2: pVSVG: pLKO.1 with TransIT-LT1 transfection reagent (Mirus). After filtering through 0.45 μm of cellulose acetate membrane (VWR ...
-
bioRxiv - Biochemistry 2024Quote: ... and TRUPATH plasmids at 1:1:1 DNA ratio (Gα-RLuc8:Gβ:Gγ-GFP2) via TransIT-2020 (Mirus Cat# MIR5400). Each condition required 97 µL of room-temperature 1x Opti-MEM (Gibco Cat# 31985070) ...
-
bioRxiv - Biophysics 2021Quote: ... δ and ε subunits in the ratio 2:1:1:1 (TransIT® 293 transfection reagent; Mirus Bio, Madison, WI). Electrophysiological experiments started ~48 hours post-transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RSV-REV in the ratio of (3:1:1:1) into HEK293T cells using Trans-IT transfection reagent (Mirus). Virus-rich supernatant was collected at 72 hr post-transfection ...
-
bioRxiv - Microbiology 2020Quote: ... were transfected with 2·5 µg serine protease expression plasmid or empty vector using TransIT-X2 Dynamic Delivery System (Mirus). One day later ...
-
bioRxiv - Immunology 2022Quote: H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transfected with 10 ug of the TRE library ± 5 ug of pcDNA3.1 containing a GPCR expression cassette using TransIT-2020 (Mirus Bio) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... pVSV-G and either pLRGatewayIRESeFYP-Vpr/Vpx or pLRGatewayIRESmApple-Vpr/Vpx at a ratio 1:1:1 with TransIT-lenti (Mirus, MIR 6603). To generate HIV vectors to make stable cell lines ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µg of each sgRNA plasmid and 3 µg of dCas9-KRAB-MeCP2 plasmid were co-nucleofected into 1 × 106 mHypoA cells resuspended in a 1:1 mixture of Ingenio Electroporation reagent (Mirus Bio 50111) and OptiMEM (Gibco 31985062) ...
-
Prom1 and Notch regulate ciliary length and dynamics in multiciliated cells of the airway epitheliumbioRxiv - Cell Biology 2022Quote: ... The VSV-G pseudotyped lentivirus was packaged by 5 plasmid co-transfection of HEK293T cells using TansIT Transfection Reagent (Mirus Bio) in 15 cm culture dishes (The protocol describing production of lentiviral particles can be found at http://www.www.bu.edu/dbin/stemcells/protocols) ...
-
bioRxiv - Microbiology 2020Quote: ... were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Cancer Biology 2023Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 1 μl TransIT (Mirus Bio TransIT-mRNA transfection kit ...
-
bioRxiv - Microbiology 2020Quote: ... or Transit LT-1 (Mirus) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Transit LT-1 (Mirus).
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were transfected with 25 nM scramble or PLIN 5 siRNA (Dharmacon, Lafayette, CO, USA) using TransIT-TKO (Mirus Bio LLC) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... 1 µl of mRNA Boost Reagent and 1 µl of TransIT-mRNA Reagent (Mirus Bio) and incubated for 5 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... and psPAX2 at a ratio of 1:1:0.1 using TransIT-LT1 transfection reagent (Mirus). The resulting blend was then filtered through a cellulose acetate membrane (0.45 µm ...
-
bioRxiv - Neuroscience 2023Quote: ... and pHR: mU6-sgRNA-EF1A-puro-P2A-BFP (sgRNA-BFP) (1:1:1) using 24 μL TransIT®-LT1 Transfection Reagent (Mirus Bio, Cat. No. MIR 2300) in a final volume of 1000uL Opti-MEM medium (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentivirus expressing specific constructs was produced by transfecting HEK-293 cells in 6-well plates with a 1:1:0.1 ratio of lentiviral vector:pMD2.G:psPAX2 using the TransIT-LT1 transfection reagent (Mirus). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... H1 plasmid library with the top 5 sgRNA per gene21 were transfected into HEK293s using the TransIT®-Lenti Transfection Reagent (Mirus, Cat. No. MIR 6606) along with third generation lentiviral packaging mix ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bait and prey plasmids containing fused fragments were then individually transfected together with VSVG and gag/pol packaging vectors in a ratio of 3:1:1 into HEK293T cells using Trans-IT Transfection reagent (Mirus) to produce retroviruses ...
-
bioRxiv - Immunology 2021Quote: ... transfected with 44 μg plasmid encoding SARS-CoV-2 Spike (pCG1-SARS-2-S, Wuhan Hu-1) using Transit LT-1 (Mirus). The next day ...
-
bioRxiv - Cell Biology 2023Quote: ... For the complementation assay 100ng of total DNA (1:1 ratio of plasmids) was transfected into 293T cells in 96-well plates using TansIT(R)-LT1 (Mirus) transfection reagent according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was performed using TransIT-LT-1 (Mirus) transfection reagent and 2500ng plasmid/flask ...
-
bioRxiv - Cell Biology 2023Quote: ... and pMDLg/pRRE) at a 1:1 ratio and transfected into HEK293T cells using TransIT LT1 transfection reagent (Mirus Bio LLC). After 72 h virus-containing supernatants were collected ...
-
bioRxiv - Cell Biology 2023Quote: Differentiated N2a cells were transfected with mRFP or syn-p2a-mRFP (1 μg) and mito GcaMP6f (1 μg) using TransIT-X2® Dynamic Delivery System (Mirus Bio) according to manufacturer’s instructions before reculturing in normal medium for 24 hours ...
-
bioRxiv - Genomics 2020Quote: ... Transit LT-1 reagent (cat. # MIR 2300) from Mirus Bio ...
-
bioRxiv - Microbiology 2021Quote: ... using 3:1 TransIT-LT1 Transfection Reagent (Mirus Bio). Twenty-four hours later ...
-
bioRxiv - Microbiology 2022Quote: ... by Trans IT LT-1 (Mirus Bio, Madison, WI). Single cell clones were established by the limit dilution method ...
-
bioRxiv - Genomics 2023Quote: ... Transit LT-1 reagent (cat. # MIR 2300) from Mirus Bio ...
-
bioRxiv - Microbiology 2022Quote: ... indicated plasmids were transfected using LT-1 Reagent (Mirus) and cells were then fixed with 5% methanol-free formaldehyde or treated with IFN or TNF-alpha before fixation ...
-
bioRxiv - Molecular Biology 2019Quote: ... RRE and REV using TransIT LT-1 transfection reagent (Mirus). Viral transductions were performed in the presence of 4-8 µg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 µL LT-1 transfection reagent (#MIR2020, Mirus Bio LLC), and 1 µL brain lysate (1ug/uL stock determined by BCA (5000001 ...
-
bioRxiv - Microbiology 2024Quote: ... pTM-P and 1 pTM-L using TransIT-LT1 (Mirus) and incubated at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... using a 3:1 ratio of TransIT-2020 (Mirus Bio) µL:µg total DNA ...
-
bioRxiv - Molecular Biology 2022Quote: Transfections were performed using Trans-IT LT1 (TLT-1) (Mirus Bio) according to the manufacturer’s instruction.
-
bioRxiv - Genetics 2019Quote: ... two master mixes were prepared: a) LT-1 transfection reagent (Mirus) was diluted 1:10 in Opti-MEM and incubated for five minutes ...
-
bioRxiv - Microbiology 2022Quote: ... by using the TransIT LT-1 transfection reagent (Mirus Bio LLC). Two days later ...
-
bioRxiv - Microbiology 2022Quote: ... Sigma-Aldrich) via the LT-1 transfection reagent (Mirus Bio LLC) in A549 or 293T cell propagation medium ...
-
bioRxiv - Cell Biology 2023Quote: ... and pCG-VSV-G using TransIT-LT-1 transfection reagent (Mirus). Subsequently ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DF-1 cells were transfected using TransIT-LT1 transfection reagent (Mirus Bio).
-
bioRxiv - Developmental Biology 2019Quote: ... These plasmids (1 µg each) were transfected by the TransIT system (Mirus) into 2×106 S2 cells that were plated in 6-well plates one day before analysis ...
-
bioRxiv - Microbiology 2023Quote: ... at a ratio of 3:1 PEI:total DNA or TransIT-LT1 (Mirus) at a ratio of 3:1 TransIT:DNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 μg each of Gβ1 and Gγ2-GFP2 using TransIT-2020 (Mirus) as transfection reagent ...