Labshake search
Citations for Biosearch Technologies :
1 - 50 of 53 citations for L lactate dehydrogenase B chain LDH B Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... NP-specific B cells or SA-specific B cells were detected with BCR specific binding with NP-PE (Biosearch Technologies) or SA-PE (BioLegend) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Coverslips were incubated in buffer B (Biosearch Technologies) containing DAPI for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then washed with Buffer B (Biosearch Technologies) for 10 minutes at room temperature.
-
bioRxiv - Cell Biology 2022Quote: ... and Wash Buffer B (Biosearch Technologies, SMF-WB1-20) are purchased from Biosearch Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... and Wash B Buffers were purchased from Biosearch Technologies. Hoechst stain was purchased from AnaSpec ...
-
bioRxiv - Molecular Biology 2023Quote: ... Additional washing step with Stellaris Wash Buffer B (Biosearch Tech) was performed for 5 min at RT before mounting the samples on the glass slides.
-
bioRxiv - Cell Biology 2023Quote: ... Hoechst stain was washed with Wash Buffer B (Biosearch Technologies) at room temperature in the dark for 5 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and nuclear counterstaining was performed using 1:10000 Hoechst 33342 in buffer A followed by two washings in buffer B (Stellaris RNA FISH Wash Buffer B (Biosearch Tech. Cat# SMF-WB1-20) and mounting the coverslips with mowiol.
-
bioRxiv - Synthetic Biology 2021Quote: ... Cells were then washed in 500 μL Wash Buffer B (Biosearch Technologies), and resuspended in 50 μL freshly filtered 5× saline-sodium citrate (SSC ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were incubated with wash B buffer (Biosearch Technologies, SMF-WB1-20) at RT for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... and stored in Wash Buffer B (LGC Biosearch Technologies, SMF-WB1-20) for imaging ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... and stored in Wash Buffer B (Cat# SMF-WA1-60, LGC Biosearch Technologies) for imaging ...
-
bioRxiv - Cancer Biology 2019Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were washed with wash buffer B (Biosearch Technologies, Cat# SMF-WB1-20) and resuspend in a small drop (approximately 30 µl ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were incubated with Wash Buffer B (cat. # SMF-WB1-20, Biosearch technologies) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... and then washed once with wash buffer B (Biosearch Technologies, SMF-WB1-20) before imaging.
-
bioRxiv - Genomics 2019Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were washed in Wash Buffer B (Biosearch Technologies SMF-WB1-20) for 5 minutes at room temperature in the dark ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 15 min and washed in RNA FISH Wash Buffer B (LGC Biosearch Technologies) for 5 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... Cells were then washed with 1 ml of Wash Buffer B (LGC Biosearch Technologies) at RT for 5 min ...
-
bioRxiv - Genomics 2023Quote: ... Cover glasses were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then resuspended in 1 mL wash buffer B (Biosearch Technologies, SMF-WB1-20), incubated for 2-5 minutes at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... Then the cells were washed briefly with Stellaris RNA FISH wash buffer B (Biosearch Technologies), rinsed three times with PBS and subject to imaging by deconvolution microscopy (DeltaVision OMX SR imaging system) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cells were then washed with Wash Buffer B (Biosearch Technologies, Inc., SMF-WA1-60) for 5 min ...
-
bioRxiv - Genomics 2021Quote: ... followed by a 5-minute wash in Wash buffer B (Biosearch Technologies, SMF-WB1-20). The coverslips were then mounted onto glass slides with Vectashield (VWR ...
-
bioRxiv - Cell Biology 2023Quote: ... washed with 500 μL Stellaris RNA FISH Wash Buffer B (Biosearch Technologies, SMF-WB1-20), and incubated in 500 μL Stellaris RNA FISH Wash Buffer B for 5 min at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... and finally with Stellaris RNA FISH Wash Buffer B (Biosearch Technologies Cat# SMF-WB1-20) for 5 minutes at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... After washing with 1 mL of Stellaris® RNA FISH wash buffer B (Biosearch Technologies) cells were mounted in Vectashield® mounting medium (Vector Laboratories) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were then washed for 5 minutes with Wash Buffer B (Biosearch Technologies, SMF-WB1-20), before sections were mounted with VECTASHIELD® Hardset™ Antifade Mounting Medium with DAPI (Vector Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed with 200 μL of wash buffer B (Biosearch Technologies Cat# SMF-WB1-20) and incubated with it at room temperature for 2-5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... A final wash step was performed using Wash buffer B (Biosearch Technologies Cat# SMF-WB1-2) for 5 mins before mounting coverslips with ProLong Gold Anti-Fade reagent (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... at 37°C and then once with Stellaris wash buffer B (Biosearch technologies SMF-WB1-20) for three minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... then in 1 mL Stellaris RNA FISH Wash Buffer B (Biosearch Technologies Cat# SMF-WB1-20) with Hoescht stain at 1:10,000 dilution for 5 min at RT ...
-
bioRxiv - Immunology 2023Quote: NP-specific memory B cells were identified by staining with biotinylated NIP(15)-BSA (Biosearch Technologies) at 330 ng/ml for 30 min on ice and then with streptavidin APC ...
-
bioRxiv - Genomics 2021Quote: ... DAPI solution was aspirated and samples were washed once with wash buffer B (Biosearch Technologies Cat# SMF-WB1-20) for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... and samples were subsequently incubated with Stellaris® RNA FISH Wash Buffer B (Biosearch Technologies; Cat #: SMF-WB1-20) as prepared through manufacturers protocol for 5 minutes at RT ...
-
bioRxiv - Microbiology 2022Quote: ... Washes and hybridization were performed with Stellaris Buffers (WASH buffer A, WASH buffer B, Hybridization Buffer; LGC Biosearch Technologies), following the manufacturer protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Each sample was then washed twice with Stellaris RNA FISH Wash Buffer B (Biosearch Technologies Cat# SMF-WB1-20) with the second wash left to incubate for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... dishes were incubated with Wash Buffer A for 30 minutes at 37°C followed by addition and incubation of Wash Buffer B (LGC Biosearch Technologies) for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were washed twice with 10% deionized formamide in 2X SSC for 30 min at 37°C and once with Wash B (Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... and samples were subsequently washed with 500 uL of Stellaris® RNA FISH Wash Buffer B (Biosearch Technologies; Cat #: SMF-WB1-20) as prepared through manufacturers and incubated with 100 uL of Stellaris® RNA FISH Wash Buffer B protocol for 5 minutes at RT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the female- and male specific splice forms of doublesex (dsxF/dsxM) and Abdominal B (AbdB) (Supp Table 3) using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA). dsxF mRNA was labeled with Quasar 570 ...
-
bioRxiv - Developmental Biology 2019Quote: ... ovaries were washed twice with Wash Buffer A at 37 °C for 30 minutes and once with Wash Buffer B (LGC Biosearch Tech, Cat# SMF-WB1-20) at room temperature for 5 minutes ...
-
bioRxiv - Immunology 2023Quote: ... were coated with anti-Ig(H+L) (Biosearch Technologies) prior to culture [20 hr ...
-
bioRxiv - Cell Biology 2022Quote: Human MYC_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2066-5), human ACTB_intron with Quasar 570 dye (Biosearch Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... human ACTB_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2002-5), Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...