Labshake search
Citations for Biosearch Technologies :
1 - 50 of 59 citations for 6 nitrobenzo d isoxazol 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... All oligos were synthesized with a 3’ amine modification (LGC Biosearch Technologies). The oligos against a given gene (oligo set ...
-
bioRxiv - Genomics 2021Quote: ... 2021) and ordered oligonucleotides with a primary amine group on the 3’ end from Biosearch Technologies (see Supplementary Table 2 for probe sequences) ...
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Bioengineering 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled each gene’s complementary oligos and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Microbiology 2019Quote: ... genomic RNA was detected with a 5’ 6-carboxyfluorescein (FAM) and 3’ black hole quencher 1 (BHQ-1) labeled probe targeting nsp2 (Biosearch Technologies, Petaluma, CA), and RNA copy number was calculated by reference to an RNA standard derived from the MHV A fragment ...
-
bioRxiv - Immunology 2021Quote: ... NP(6)-BSA-biotin (Biosearch Technologies) was pre-incubated for 30 min with streptavidin-APC in a 1:1 molar ratio ...
-
bioRxiv - Microbiology 2024Quote: ... FailSafe PCR 2X PreMix D or G (LCG, Biosearch Technologies) were used as buffer for all PCR reactions.
-
bioRxiv - Cell Biology 2022Quote: ... Oligonucleotides with 3’ amino group (LGC Biosearch Technologies) were pooled and coupled with either Cy®3 Mono NHS Ester (GE healthcare ...
-
bioRxiv - Immunology 2020Quote: ... with 4-hydroxy-3- nitrophenylacetyl-O-succinimide ester (Biosearch Technologies).
-
bioRxiv - Genetics 2020Quote: 4-hydroxy-3-nitrophenylacetic acid succinimide ester (LGC, Biosearch Technologies)
-
bioRxiv - Immunology 2021Quote: ... C57BL/6 recipient mice were pre-immunized by intraperitoneal injection of 100 µg OVA (BioSearch Technologies) dissolved in PBS and precipitated in alum (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
bioRxiv - Immunology 2021Quote: ... with 100 μg 4-hydroxy-3-nitrophenyl acetyl (NP)-CGG (Biosearch Technologies) in alum (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: Probe sets targeting the 3’UTR of rat Atf3 (Stellaris probes, Biosearch technologies) were designed using the Stellaris probe-set designer tool to specifically detect the 3’UTR of the transcript and 3’end labelled with CalFluor590 ...
-
bioRxiv - Molecular Biology 2023Quote: Two sets of 3’-end biotinylated RNA oligonucleotides (LGC Biosearch Technologies; Risskov, Denmark) (Table S3 ...
-
bioRxiv - Biophysics 2023Quote: All oligonucleotides used in this work (Table S2) were synthesized using a MerMade 6 instrument (LGC, Biosearch Technologies) at 1 μmol scale ...
-
bioRxiv - Plant Biology 2022Quote: ... and each probe was synthesized with a 3’ amino modification (LGC Biosearch Technologies, CA) (Table S3) ...
-
bioRxiv - Genetics 2023Quote: ... The probes with 3’ MdC(TEG-Amino) modifications were then ordered from Biosearch Technologies in 96-well plate format ...
-
bioRxiv - Microbiology 2019Quote: ... Re-hydrated samples were hybridized with 62.5 nM of an equimolar mixture of Cy3-labelled DNA probes designed to target the coding region of the gene segment 6 of simian rotavirus A/SA11 (Genbank Acc. AY187029.1) using Stellaris Probe Designer v2 software (LCG Biosearch Technologies), in a total volume of 200 µl of the hybridization buffer (Stellaris RNA FISH hybridization buffer ...
-
bioRxiv - Microbiology 2021Quote: ... (5’ – TCA GTC TTC CGA CCA TTG – 3’)31,57 and was manufactured by Biosearch Technologies, Petaluma ...
-
bioRxiv - Genomics 2022Quote: ... The 3’ end of each oligonucleotide probe was fluorescently tagged using Quasar dyes (Biosearch technologies). Bl6-specific oligos were labelled with Quasar 570 and Cast-specific oligos labelled with Quasar 670 ...
-
bioRxiv - Immunology 2023Quote: ... or 1 mg 4-hydroxy-3- nitrophenyl (NP)-OVA (LGC Biosearch Technologies, N-5051-100) by oral gavage with 5 μg cholera toxin (List Biological Labs ...
-
bioRxiv - Developmental Biology 2023Quote: ... Custom 20 nt oligonucleotides with a 3’NHS ester modification were obtained from Biosearch Technologies, conjugated to either Atto 565 (Sigma ...
-
bioRxiv - Immunology 2023Quote: Mice were injected intraperitoneally with 50μg of 4-hydroxy-3-nitrophenylacetyl (NP)-CGG (BioSearch Technologies) in PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous Cdc42 isoforms were detected with 5’ Cy5-labelled Stellaris probes to the exons 6 or 7 (probe sequences available upon request; BioSearch Tech.). Hybridization conditions for Stellaris probes for cultured neurons and for tissue sections was performed as recently described (Terenzio et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... diluted 1:6 in nuclease free H2O and 5 µl were used for Kompetitive allele specific PCR (KASP) genotyping (LGC Biosearch Technology) (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2023Quote: ... the glass coverslips were transferred to a fresh 6-well plate with the cell side up and incubated with Wash Buffer A (Biosearch Technologies) and Hoechst stain (1:2000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... to a 24mer DNA oligo containing a Quasar 670 (Cy5) fluorophore at the 3’ end (Biosearch Technologies) that was purified as described previously (He et al. ...
-
bioRxiv - Immunology 2021Quote: ... or 50 ug of alum-precipitated 4-Hydroxy-3-nitrophenylacetyl (NP)-chicken gamma globulin (CGG) (Biosearch Technologies). For adoptive transfer experiments ...
-
bioRxiv - Immunology 2021Quote: ... and incubating with anti-Ki-67 or 4-hydroxy-3-nitrophenylacetyl conjugated to phycoerythrin (NP-PE) (Biosearch Technologies) in Perm/Wash buffer for 30 min ...
-
bioRxiv - Immunology 2019Quote: Mice were immunized intra-peritoneally with 25 μg of 4-hydroxy-3-nitrophenylaceyl-lipopolysaccharide (NP-LPS) (Biosearch Technologies). Blood ...
-
bioRxiv - Immunology 2021Quote: 7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
bioRxiv - Immunology 2022Quote: ... we employed a prime-boost approach in which 8-10 wk old age and sex matched mice were immunized intraperitoneally (i.p.) with 200µg of 4-Hydroxy-3-nitrophenylacetyl-Keyhole Limpet Hemocyanin (NP-KLH, Biosearch Technologies) mixed with Complete Freund’s Adjuvant (CFA ...
-
bioRxiv - Immunology 2022Quote: ... mice were injected intraperitoneally with 100µg of 4-Hydroxy-3-nitrophenylacetyl hapten-17 (NP17)-OVA (Biosearch Technologies, 1µg/mL) mixed with Imject Alum (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... Immunizations/infections were performed intraperitoneally (ip) with 100μg of 4-hydroxy-3-nitrophenylaceyl-keyhole limpet hemocyanine (NP-KLH) (Biosearch Technologies) adjuvanted with alum (Inject Alum ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Immunology 2023Quote: ... animals were immunized by intrafootpad injection of 10μg of 4-hydroxy-3-nitrophenyl-acetyl (NP) hapten conjugated to the Keyhole limpet hemocyanin (NP-KLH) (Biosearch Technology) mixed with 10 µL of Imject™ Alum (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Custom Stellaris FISH probes were designed to recognize NL4-3 HIV-1 gag-pol reading frame nucleotides 386-4456 using the Stellaris RNA FISH Probe Designer 4.1 (Biosearch Technologies, Inc.) available online ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Cell Biology 2021Quote: ... S4 cDNA was detected using a fluorogenic probe (5′-FAM [fluorescent fluorescein]-AGCGCGCAAGAGGGATGGGA-BHQ [black hole quencher]-1-3′; Biosearch Technologies).
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Cancer Biology 2022Quote: ... at the 5′ end as the reporter fluorophore and with Black Hole Quencher 1 (BHQ1) at the 3′ end as the quencher (Biosearch Technologies). qPCR reactions were performed in a 20-µL volume containing 100 ng genomic DNA template (estimated by UV spectrophotometry ...
-
bioRxiv - Immunology 2022Quote: Wt and TNS3 nc/nc littermates (8–12 weeks old) were immunized by intraperitoneal injection with 200 μg of 4-Hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG, Biosearch Technology) in alum (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: Mice (aged 2–6 months) were injected intraperitoneally with 50 μg of 4-hydroxy-3-nitrophenylacetyl conjugated to chicken gamma globulin (NP-CGG) (Biosearch Technologies) in Imject Alum (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...