Labshake search
Citations for abcam :
1 - 50 of 5805 citations for Recombinant Mouse Erbb2 protein Fc tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: Extracellular domain Fc fusions for human CTLA4 (CTLA4-Fc) and ErbB2 (ErbB2-Fc) were purchased from Abcam (ab180054 and ab168896). These ligands were biotinylated by the EZ-link® Sulfo-NHS-LC-Biotin according to the manufacturer’s protocol (Thermo Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Recombinant 6xHis-tagged human GRP78 protein (Abcam, Cambridge, UK) was biotinylated with EZ-Link Sulfo-NHS-Biotin (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... recombinant mouse WNT3a protein (Abcam) 50ng/ml was added and cells cultured for 8 hours before lysis in Trizol.
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant His-tagged human ATG4B (Abcam, ab188707) was pre-treated with 10 mM DTT for 15 mins ...
-
bioRxiv - Microbiology 2021Quote: ... recombinant hexahistidine-tagged HA was precomplexed with a mouse anti-his Alexa 647 antibody (Abcam) and goat - anti-mouse Alexa 647 antibodies ...
-
bioRxiv - Immunology 2023Quote: ... 100 ng of Recombinant mouse IRE1 protein (ab268540, Abcam) was added into and incubated with the IP product at 30℃ for 30 min ...
-
bioRxiv - Immunology 2021Quote: Recombinant mouse MMP9 protein was purchased from Abcam (Cambridge, MA). To obtain maximum latent MMP9 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and ErbB2 (Abcam, Cambridge, UK), and then reacted with peroxidase conjugated secondary antibody (Jacson Immuno Research ...
-
bioRxiv - Immunology 2021Quote: ... Labelling of recombinant proteins was carried out using APC and PE conjugation lightning-link kits (Abcam). When using biotinylated antibodies ...
-
bioRxiv - Molecular Biology 2024Quote: ... and incubated with 6µg recombinant GST-tagged XPO1 (ab131897, Abcam) for 1 hour at 4°C on a wheel ...
-
bioRxiv - Microbiology 2020Quote: ... mCherry tagged proteins were analyzed by Western blot using mouse anti-mCherry (Abcam ab125096).
-
bioRxiv - Immunology 2023Quote: ... the antigen TT was labeled in-house with APC (APC Conjugation Kit – Lightning-Link®, Abcam, ab201807 ...
-
bioRxiv - Neuroscience 2022Quote: ... 4μl of 2μg/μl of recombinant mouse α-synuclein protein PFF (Abcam, ab246002) was unilaterally administered in the striatum region of the rat brain and simultaneously 4μl of PBS was injected in the sham-operated control rats (Paumier et al ...
-
bioRxiv - Systems Biology 2023Quote: ... for 48hours together with either recombinant-mouse TIMP1 protein (1µg/ml, ab206786, Abcam), PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... ovalbumin and CD4-Fc fusion proteins were labelled with allophycocyanin (APC) with the Lightning-Link Labelling Kit (Abcam, Cambridge, UK).
-
bioRxiv - Biochemistry 2019Quote: ... recombinant human PD-L1 protein and recombinant human tau protein were purchased from Abcam. HRP-conjugated goat anti-Mouse IgG (H+L ...
-
bioRxiv - Neuroscience 2023Quote: ... Recombinant MAP2c protein (Abcam, #ab114686), carrying a ∼26 kDa Glutathione-S-Transferase (GST ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 100 ng/ml of active mouse recombinant Ifng protein (Abcam, catalog number: 259378) for 3 days ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Anti-ErbB2 affibody molecule (Ab31889) was purchased from Abcam and labelled with Methyltetrazine-PEG4-maleimide ...
-
bioRxiv - Immunology 2021Quote: ... Two anti-His secondary antibodies separately labeled with APC and PE (Abcam) were both used to recognize the RBD bait and exclude nonspecific staining ...
-
bioRxiv - Neuroscience 2022Quote: ... Recombinant human Neuritin protein (Abcam, ab69755) was reconstituted in water to a concentration of 0.1 mg/mL ...
-
bioRxiv - Genetics 2023Quote: Recombinant SORBS1 protein (Abcam; Cambridge, UK) was incubated with recombinant GST-DOCK3-PXXP or GST alone plasmids (constructs cloned into pGEX-6P-1 plasmid ...
-
bioRxiv - Biochemistry 2023Quote: Recombinant human IRF5 protein (Abcam, ab173024) (500 ng ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-APC (mouse IgG2b, 1:300, Abcam), anti-human GFAP (mouse IgG1 ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant human coronavirus SARS-CoV-2 spike glycoprotein S1 (Fc Chimera) (ab272105, Abcam) was used as positive control (loaded 2.4 ug/lane) ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant GST-tagged PKR kinase domain (Abcam; 1/2/3/4.4/6.7/10/12.5 ng) or protein lysis buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... recombinant human G6PD protein (Abcam, cat#NP0007) was also included ...
-
bioRxiv - Cell Biology 2024Quote: ... or GSK3β recombinant protein (Abcam, Cambridge, UK) was added to the dephosphorylated protein substrates in the presence of 250 μM ATP and incubated for 30 min at 30°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins of interest were labeled with the following primary antibodies: NDUFS3 (mouse, abcam, ab110246, 1:100), SDHA (mouse ...
-
bioRxiv - Immunology 2020Quote: ... RBD protein was directly labelled to APC using an APC Conjugation Lightning-Link Kit (Abcam). For murine studies ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-APC (CC1, 1:100, Abcam ab16794), rabbit anti-Olig2 (1:100 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 100ng/mL recombinant mouse Noggin (abcam, ab281818), 50ng/mL hEGF (R&D Systems ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were treated with 4 μg/ml of Recombinant Mouse α-Syn Protein Aggregate (Active) (Abcam, ab246002) for periods of 24 ...
-
bioRxiv - Microbiology 2021Quote: ... Protein binding between FXa-Fc or Fc and S protein was detected by immunoblotting using an anti-S protein antibody (ab272504, Abcam).
-
bioRxiv - Molecular Biology 2022Quote: ... 100 µL biotinylated recombinant human ACE2 protein (His AVI Tag, 0.25 µg/µL, 1:100) (Sinobiology) and recombinant streptavidin protein (phycoerythrin) (Abcam) were used as the primary and secondary antibodies for ACE-2 protein detection ...
-
bioRxiv - Bioengineering 2023Quote: ... EPO receptor protein (Fc chimera active; Abcam, USA) was immobilized on Series S Sensor Chips CM5 (GE Healthcare ...
-
bioRxiv - Neuroscience 2021Quote: ... YFP-tagged SGK1.1 and GFP-tagged Kv7 subunits were detected using mouse anti-GFP monoclonal antibody (Abcam, ab290). Nedd4-2 was detected with a rabbit polyclonal antibody from Cell Signaling (4013S) ...
-
bioRxiv - Cell Biology 2021Quote: ... Recombinant Akt1 protein was purchased from Abcam (#ab79792). The binding assay was performed in PBST by incubating a constant amount of His-tagged p53 with an increasing amount of Akt1 in the presence of 20 μl anti-p53 antibody-conjugated agarose (#sc-126AC ...
-
bioRxiv - Cancer Biology 2020Quote: Recombinant human COX1 protein (Abcam, Ab-198643, 4ng), human COX2 protein (Cayman Chemical ...
-
bioRxiv - Neuroscience 2023Quote: ... Recombinant Human DBI protein (Abcam, Cat. No ab84342) was intrathecally injected at 10 ng per delivery ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant Protein G (HRP) (Abcam, #ab7460; 1:5000), Goat Anti-Rabbit IgG H&L (HRP ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-APC (1:300, catalog no. ab16794; Abcam), rabbit anti-citrullinated MBP (1:300 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-APC (clone CC1) 1:100 (Abcam, #ab16794); rabbit anti-NG2 1:200 (Millipore ...
-
bioRxiv - Plant Biology 2019Quote: ... tagged proteins were detected using α-c-Myc antibody (Abcam ab32072), α-GFP antibody (Roche 11814460001 ...
-
bioRxiv - Neuroscience 2023Quote: ... Blockade of IL-1R was performed using the recombinant mouse IL1-RA protein (1-1000 mg/mL, abcam #ab283475).
-
bioRxiv - Cell Biology 2022Quote: ... dyLight488-labeled goat anti-rabbit IgG and Alexa488-labeled goat anti-mouse IgG (Abcam). The cells were mounted in mounting medium.
-
bioRxiv - Immunology 2020Quote: ... followed by incubation with PE-labeled goat anti-human IgG-Fc antibody (1:5000; Abcam) for 30 min and analyzed by flow cytometry.
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Mouse IgG (Abcam, #ab131368). The primers GFP-forward (CGAAGGCTACGTCCAGGAGC ...
-
bioRxiv - Cancer Biology 2020Quote: ... or Recombinant Human DLK-1 protein (Abcam Cat# ab151926). For HIF2alpha inhibition ...
-
bioRxiv - Molecular Biology 2022Quote: ... Recombinant AAT protein was purchased from Abcam (Waltham MA). Human neutrophil elastase (NE ...