Labshake search
Citations for abcam :
1 - 50 of 10000+ citations for Goat Anti Human IgG Mouse Adsorbed HRP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The secondary antibodies included: (1) goat anti-human IgG Fc (HRP) pre-adsorbed (catalog no. ab98624; Abcam); (2 ...
-
bioRxiv - Microbiology 2023Quote: ... goat anti-human IgA alpha chain (HRP) pre-adsorbed (catalog no. ab98558; Abcam); and (3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... or Goat Anti-Mouse IgG HRP (Abcam, Catalog No ...
-
bioRxiv - Cell Biology 2022Quote: ... HRP-conjugated goat anti-mouse IgG (ab6789, Abcam) was diluted 1:10000 and HRP-conjugated goat anti-rabbit IgG (ab6721 ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Mouse IgG (Abcam, #ab131368). The primers GFP-forward (CGAAGGCTACGTCCAGGAGC ...
-
bioRxiv - Cell Biology 2022Quote: ... HRP-conjugated goat anti-mouse IgG (ab6789, Abcam), HRP-conjugated goat anti-rabbit IgG (ab6721 ...
-
bioRxiv - Microbiology 2023Quote: ... and (3) goat anti-human IgM mu chain (HRP) pre-adsorbed (catalog no. ab98549; Abcam). After washing away the unbound secondary antibodies ...
-
bioRxiv - Microbiology 2020Quote: ... then incubated with 0.1μg/ml HRP-conjugated Goat Anti-Human IgG H&L or HRP-conjugated Goat Anti-Rabbit IgG H&L (abcam) in 0.5% BSA in PBST for 1h at RT ...
-
bioRxiv - Biochemistry 2020Quote: ... goat anti-human IgG H&L (HRP) (ab6858, Abcam plc), anti-apolipoprotein E antibody (Biotin ...
-
bioRxiv - Immunology 2020Quote: ... HRP conjugated goat anti-human IgG Fc was from Abcam, Cambridge ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by HRP goat anti-human IgG (Fab’)2 (Abcam) or HRP donkey anti-rabbit IgG (Cell Signaling ...
-
bioRxiv - Cancer Biology 2021Quote: ... Goat anti-mouse IgG H&L (HRP) (Abcam, #6789).
-
bioRxiv - Cell Biology 2019Quote: ... Goat anti–mouse secondary antibody IgG-HRP (ab97051, Abcam) and anti–rabbit IgG-HRP (ab205719 ...
-
bioRxiv - Immunology 2022Quote: ... goat anti-mouse IgG H&L conjugated HRP (Abcam), was incubated in plate at room temperature for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... Goat Anti-Mouse IgG H&L (HRP) (ab205719, Abcam), Goat Anti-Mouse IgG Alexa Fluor® 488 (GB25301 ...
-
bioRxiv - Plant Biology 2022Quote: ... goat anti-mouse IgG H&L (HRP) (ab205719, Abcam) was used at a dilution of 1:10,000 ...
-
bioRxiv - Neuroscience 2024Quote: ... or Goat Anti-Mouse IgG H&L (HRP) (Abcam, ab205719 ...
-
bioRxiv - Microbiology 2022Quote: ... The secondary antibodies used included: goat anti-rabbit IgG HRP-conjugated and goat anti-mouse IgG HRP-conjugated secondary antibody (1:5000, Abcam), Alexa Fluor 555 goat anti-rabbit IgG (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... goat anti-rabbit IgG H+L (HRP, ab205718) and goat anti-mouse IgG H+L (HRP, ab 205719) from Abcam and anti-Vpu rabbit polyclonal serum as described previously (72) ...
-
bioRxiv - Neuroscience 2022Quote: ... Membranes were then incubated with secondary antibodies (diluted 1:2500 in nonfat dry milk): goat anti-rabbit IgG HRP or goat anti-mouse IgG HRP (all from Abcam). Bands were visualised using Pierce ECL Western Blotting Substrate (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Goat Anti-Mouse IgG H&L (HRP) (Abcam, ab97051), and were diluted 1:10,000 in 5% milk PBST ...
-
bioRxiv - Neuroscience 2023Quote: ... and Goat Anti-Mouse IgG H&L (HRP) (ab6789, Abcam) were used as primary and secondary antibodies ...
-
bioRxiv - Immunology 2021Quote: ... anti-human IgG-HRP (Abcam), was added to each well at 1:20,000 dilution in PBS-T and incubated for 1hr at RT ...
-
bioRxiv - Immunology 2019Quote: ... anti-human IgG-HRP (Abcam), in PBS-T was added to each and incubated for 1hr at RT ...
-
bioRxiv - Microbiology 2021Quote: ... horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG and HRP-conjugated goat anti-mouse IgG were purchased from Abcam (Cambridge, MA, USA). Purified ZIKV-E protein from Escherichia coli was purchased from MyBioSource (San Diego ...
-
bioRxiv - Physiology 2023Quote: ... Alexa 488 goat anti-mouse IgG (H+L) pre-adsorbed secondary antibody (ab150117, 1:250, Abcam); rabbit polyclonal anti-KCNQ2 (ab22897 ...
-
bioRxiv - Microbiology 2020Quote: ... HRP-conjugated goat anti-human-IgG secondary antibody was used (Abcam, ab6858). Convalescent serum from a patient in the 2013-2016 EVD outbreak in West Africa ...
-
bioRxiv - Cell Biology 2021Quote: ... Goat Anti-Mouse IgG H&L (HRP) (Abcam, 1:1000, ab6789), Rabbit Anti-Goat IgG H&L (HRP ...
-
bioRxiv - Cell Biology 2022Quote: ... Goat Anti-Mouse IgG H&L (HRP) (Abcam, ab6789 1:10,000), Goat Anti-Rabbit IgG H&L (HRP ...
-
bioRxiv - Microbiology 2020Quote: ... Binding was detected using HRP-conjugated goat anti-mouse IgG (Abcam) and incubated for one hour at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... HRP-conjugated goat anti-mouse IgG (1:5,000 dilutions, Abcam, UK), goat anti-mouse IgA (1:5,000 dilutions ...
-
bioRxiv - Immunology 2020Quote: ... and goat polyclonal anti-mouse IgG (HRP) (ab6789, Abcam, 1:5000).
-
bioRxiv - Genetics 2020Quote: ... Goat Anti-Mouse IgG H&L (HRP) (1:5000; ab205719, Abcam).
-
bioRxiv - Cell Biology 2023Quote: ... 1:4000 ab205719 Goat Anti-Mouse IgG H&L HRP (Abcam)) ...
-
bioRxiv - Microbiology 2023Quote: ... specifically goat anti-mouse IgG (HRP)-conjugated antibody (ab6789, Abcam, UK) and goat anti-mouse sIgA HRP-conjugated antibody (ab97235 ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated with pre-adsorbed secondary antibodies (1:500 Goat anti-mouse IgG AF647, 1:500 Goat anti-rabbit IgG AF555; Abcam cat. no. ab150119 and ab150086) for 1 hour at RT ...
-
bioRxiv - Microbiology 2023Quote: ... anti-human IgG-HRP (Abcam ab97225) diluted 1:10,000 in blocking solution ...
-
bioRxiv - Microbiology 2023Quote: ... anti-human IgG-HRP (Abcam ab97225) diluted 1:10,000 in blocking solution ...
-
bioRxiv - Biochemistry 2022Quote: ... Goat anti- human HRP (Abcam ab7153) was added at a 1:5,000 dilution in PBST ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by polyclonal goat anti-mouse IgG-HRP (1:7,500; ab6728, Abcam) or polyclonal swine anti-rabbit IgG-HRP (1:5,000 ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by polyclonal goat anti-mouse IgG-HRP (1:7,500; ab6728, Abcam) or polyclonal swine anti-rabbit IgG-HRP (1:5,000 ...
-
bioRxiv - Immunology 2024Quote: ... Goat anti-mouse IgG HRP conjugated secondary antibody (Abcam ab205719, 1:1000) was then added and incubated for 2 hours RT ...
-
bioRxiv - Microbiology 2024Quote: ... Goat IgG anti-mouse IgG-horseradish peroxidase (HRP) conjugated were purchased from Abcam (Cambridge, UK). Blue-fluorescent DNA stain 4’,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Microbiology 2022Quote: ... goat anti-rabbit IgG-HRP (ab6721, Abcam) or anti-mouse IgG-HRP (7076 ...
-
bioRxiv - Microbiology 2021Quote: ... or goat-anti-rabbit IgG-HRP (Abcam). After incubation for 1 hr at 37°C and five washes with PBS-T buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... goat anti-rat IgG HRP (Abcam/ab57057) or rabbit anti-goat IgG HRP (Agilent technologies/P044901-2 ...
-
bioRxiv - Microbiology 2022Quote: ... and a 1:10,000 dilution of secondary HRP-conjugated goat anti-human IgG (Abcam) was added ...
-
bioRxiv - Microbiology 2022Quote: ... and a 1:100,000 dilution of secondary HRP-conjugated goat anti-human IgG (Abcam) was added ...
-
bioRxiv - Microbiology 2019Quote: ... and HRP-anti-mouse IgG (Abcam) for ELISA.
-
bioRxiv - Microbiology 2023Quote: ... HRP-anti-mouse-IgG (ab205719, Abcam), streptavidin-HRP (21130 ...