Labshake search
Citations for Charles River Labs :
1 - 50 of 1390 citations for Rat Neuronal Acetylcholine Receptor Subunit Alpha 7 CHRNA7 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: Low density rat cortical neuronal cultures were prepared from embryonic day (E) 18 rat embryos (Charles River) as previously described(Verpelli et al. ...
-
bioRxiv - Neuroscience 2023Quote: Postnatal glia-free rat cortical neuronal cultures were prepared from male P1 rat pups (Sprague Dawley, Charles River Laboratories, SD-001). Cerebral cortices were micro-dissected and enzymatically dissociated with papain (~7.5 units/mL ...
-
bioRxiv - Immunology 2021Quote: The rat study was performed using 7-week-old male Crl:CD (SD) rats (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Neuroscience 2020Quote: Neuronal cultures were prepared from embryonic day 17 Sprague-Dawley rats (Charles River, Wilmington, MA, USA). Embryos were obtained from two to three pregnant dams ...
-
bioRxiv - Genetics 2021Quote: ... Postnatal day 7-10 old Sprague-Dawley rats (Charles River) bred in-house were sacrificed via cervical dislocation and cortex was quickly dissected ...
-
bioRxiv - Neuroscience 2019Quote: Male Long-Evans rats (n = 7; Charles River Labs, Wilmington, MA) were housed individually in plexiglass cages and kept on a 12-h light/dark cycle ...
-
bioRxiv - Bioengineering 2021Quote: ... Rats (7-week-old male Sprague-Dawley, Charles River Japan Inc.) were anesthetized by inhalation of 2.5% isoflurane ...
-
bioRxiv - Pathology 2021Quote: Male athymic rnu/rnu rats (age 6-7 weeks, Charles River) weighing 160-200 g were used ...
-
bioRxiv - Cell Biology 2024Quote: All neuronal experiments utilized wild-type rats of the Sprague-Dawley strain (Charles River code 400, RRID: RGD_734476). These experiments were conducted in accordance with approved protocols by the Weill Cornell Medicine IACUC ...
-
bioRxiv - Molecular Biology 2020Quote: Adult female Long Evans rats (7 week) were purchased from Charles River, Canada (St ...
-
bioRxiv - Neuroscience 2020Quote: Male CD rats (7-8 weeks old) were purchased from Charles River and male C57BL/6J mice (8-12 weeks old ...
-
bioRxiv - Neuroscience 2020Quote: Wistar female rats (7-10 weeks old) and C75BL/6J mice (7-12 weeks old) were purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: Adult male Long Evans rats (Charles River, 7 weeks on arrival, n = 124) were use throughout ...
-
bioRxiv - Neuroscience 2024Quote: Male and female Sprague Dawley rats (age 3–7 weeks; Charles River Laboratories) were anesthetized with isoflurane ...
-
bioRxiv - Neuroscience 2020Quote: ... was transferred into the home cage of a retired aggressive male Brown Norway (BN) rat (>7 months old; all rats from Charles River Laboratories Japan ...
-
bioRxiv - Neuroscience 2021Quote: Experiments were performed on 5-7 week-old Wistar male rats (Charles River Laboratories) that were housed in a 12 hours light/dark cycle with food and water available ad libitum ...
-
bioRxiv - Cell Biology 2023Quote: Specific pathogen-free 7 weeks-old female Wistar rats (Charles River Japan, Atsugi, Japan) were used ...
-
bioRxiv - Bioengineering 2020Quote: ... Male Lewis rats at 7-weeks of age were obtained from Charles River (Strain 004) and housed on a 12-hour light/dark cycle while fed ad libitum (LabDiet ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Male and female F344 rats at 6-7 weeks old were purchased from Charles River Laboratories Japan ...
-
bioRxiv - Neuroscience 2019Quote: ... 7-week-old adult male and female Long Evans rats were purchased from Charles River Canada (St ...
-
bioRxiv - Neuroscience 2023Quote: ... PH was induced in 98 male Sprague-Dawley rats (5-7 weeks, 150-200g, Charles River) using either the Sugen-Hypoxia-Normoxia (SuHxNx ...
-
bioRxiv - Neuroscience 2021Quote: Male Sprague-Dawley rats were acquired at 7-8 weeks of age from Charles River (Wilmington, MA). Male and female mice lacking CaIDAG-GEFI and wildtype sibling controls were generated by intercrossing heterozygous knockout mice in a congenic C57BL/6J genetic background at the Massachusetts Institute of Technology ...
-
bioRxiv - Neuroscience 2020Quote: ... using experimentally naïve male Sprague Dawley rats acquired at age 7-8 weeks (Charles River, Wilmington, MA). Rats were group-housed up to 4/cage until catheter implantation ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-7 week old male Sprague-Dawley rats (Crl:SD, strain code 400; Charles River Laboratories, Wilmington, MA) were weighed and randomized into experimental groups as indicated below for the dose-range finding study (n=24 ...
-
bioRxiv - Neuroscience 2022Quote: ... Male Wistar rats 225-250g were ordered 7-10 days prior to surgery (Charles River Laboratories, Wilmington MA). They were allowed free access to food and water and housed two per cage.
-
bioRxiv - Neuroscience 2019Quote: RGCs were purified by sequential immuno-panning from P7 (postnatal day 7) Sprague-Dawley rat retinas (Charles River) as previously described (Barres et al. ...
-
bioRxiv - Neuroscience 2023Quote: A total of 7 young-adult male Long-Evans rats (325g – 335g; 10 weeks on arrival; Charles River) were included in this study after meeting inclusion criteria on the behavioral task and surviving both surgical procedures (out of 12 animals) ...
-
bioRxiv - Neuroscience 2024Quote: ... young adult (6-7 weeks old) and adult (12 weeks old) male outbred Wistar rats (Charles River, Barcelona, Spain) essentially as previously described [36,38] and all protocols and procedures were performed according to ARRIVE guidelines for experimental design ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... we used 7 male Sprague Dawley rats (21-22 weeks old, 500-600 g; Charles River, Barrier R04, Raleigh, NC). For Experiment 3 ...
-
bioRxiv - Bioengineering 2021Quote: ... All animals used in this study were 7-8-week-old Sprague Dawley rats (~225 g, Charles River Laboratories, Wilmington, MA). Following general anesthesia of oxygen and isoflurane ...
-
bioRxiv - Neuroscience 2020Quote: ... We studied 29 Wistar Rats (saline: 6 males, 6 females; fentanyl: 7 males, 10 females) obtained from Charles River (Wilmington, MA), ranging in weight from 247 to 586 grams and 3 to 6 months of age at baseline ...
-
bioRxiv - Bioengineering 2022Quote: ... All animals used in this study were 7–8-week-old Sprague Dawley rats (∼225 grams, Charles River Laboratories, Wilmington, MA). After general anesthesia of oxygen and isoflurane ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: The pharmacokinetic (PK) study was carried out in Sprague-Dawley rats weighing 180-250g (7-9 weeks old) provided by Charles River Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... each SD rat was transferred into the home cage of a retired aggressive male Brown Norway (BN) rat (>7 months of age; Charles River Laboratories Japan). The resident BN rat was allowed direct physical contact with the SD rat (intruder ...
-
bioRxiv - Cell Biology 2021Quote: ... we used heterozygous P23H rats obtained by crossing homozygous RHOP23H rats with RHOWT rats (CDH IGS Rat; Charles River, Germany). Animals were housed in the Institute for Ophthalmic Research animal facility under standard white cyclic lighting ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Adult female (n = 10) and male (n = 7) CD Sprague–Dawley rats were obtained from a commercial supplier (Charles River Laboratories, Senneville, QC, Canada). Rats weighed 308 - 412 g (females ...
-
bioRxiv - Cell Biology 2023Quote: Complete spinal cord transection at T8 was performed in male Sprague Dawley rats (6-7 weeks of age, ∼250 grams, Charles River Laboratories, Wilmington, MA) under isoflurane anesthesia essentially as described [17] ...
-
REV-ERBα mediates complement expression and circadian regulation of microglial synaptic phagocytosisbioRxiv - Neuroscience 2020Quote: WT Neuronal and astrocyte cultures were obtained from CD1 mice from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... we employed heterozygous P23H rats obtained by crossing homozygous P23H transgenic rats with wild-type rats (CDH IGS Rat; Charles River, Germany).
-
bioRxiv - Neuroscience 2023Quote: Rats: Sprague Dawley rats (Charles River stock number 001) were housed with a 12-hour light/dark cycle in the Salk Institute animal facilities ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... we used SERT−/− rats and wild-type WistarCrI:WI rats (WT rats) from Charles River (Horst, the Netherlands) as behavioral wild-type controls (see experimental design in figure 1) ...
-
bioRxiv - Neuroscience 2020Quote: ... we employed heterozygous P23H rats obtained by crossing with WT rats (CDH IGS Rat; Charles River, Germany). RhoP23H/P23H (P23H KI ...
-
bioRxiv - Pathology 2022Quote: ... ZDL rats and ZDF rats were purchased from Charles River Laboratories (Yokohama ...
-
bioRxiv - Developmental Biology 2022Quote: ... plus 50% rat serum (rat whole embryo culture serum, Charles River) and 25% human chord serum obtained from the Cambridge Blood Biobank ...
-
bioRxiv - Neuroscience 2021Quote: ... Neuronal cell cultures were dissociated from E16 pregnant C57/6N females purchased from Charles River. See key resources table for more information.
-
bioRxiv - Neuroscience 2021Quote: Rat cortical neuron cultures were dissociated from E18 rat embryos (Charles River) and plated on coverslips coated with poly-D lysine (Millipore Sigma cat # P2636 ...
-
bioRxiv - Bioengineering 2020Quote: Primary rat islets were isolated from 12-week Wistar Rats (Charles River) as previously described1,4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and wildtype rats (Charles River; Sprague-Dawley® rat, strain code 400).
-
bioRxiv - Neuroscience 2021Quote: ... Wistar rats (Charles River) aged 60-70 days or 120-180 days ...